Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGL3-DICER-Prom upstream Ebox Mut Resource Report Resource Website |
RRID:Addgene_25852 | DICER-Promoter upstream Ebox Mut | Homo sapiens | Ampicillin | PMID:20550935 | Backbone Size:5394; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | ||
|
pLL3.7_hsa-miR-30c Resource Report Resource Website |
RRID:Addgene_25797 | hsa-miR-30c | Homo sapiens | Ampicillin | PMID:19584398 | miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3' | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 0 | |
|
pLL3.7_hsa-miR-150 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25792 | hsa-miR-150 | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 1 | ||
|
pLL3.7_hsa-miR-34a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25791 | hsa-miR-34a | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:48 | 4 | ||
|
pSIREN-RetroQ-MYB-shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_25790 | shRNA against human MYB | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 1 | ||
|
HA-HIF2α P405A/N847A Δ450-572-pBabe-Puro Resource Report Resource Website |
RRID:Addgene_25936 | Hypoxia inducible factor 2 alpha | Homo sapiens | Ampicillin | PMID:17220275 | Backbone Size:5140; Vector Backbone:HA-pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | cDNA changed amino acids: Proline 405 to Alanine Asparagine 847 to Alanine internal deletion of Amino acids 450 - 527 (NTAD = N-terminal transactivation domain) This mutant is called "M4" in Yan et al. 2007, Mol Cell Biol, 27, 209-2-102 . | 2026-08-15 01:12:49 | 0 | |
|
pCMV5-Flag-RapR-p38 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25935 | RapR-p38 | Homo sapiens | Ampicillin | PMID:20581846 | Note that the Addgene quality control sequence does not match the author-supplied sequence exactly. There is NO PstI site at the end of the insert. | Backbone Size:4600; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:46 | 2 | |
|
pWPI_SPbFGF Resource Report Resource Website 1+ mentions |
RRID:Addgene_25812 | pWPI_SPbFGF | Homo sapiens | Ampicillin | PMID:17728358 | Backbone Size:11101; Vector Backbone:pWPI; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Ig signal peptide in N-terminal of human FGF2 | 2026-08-15 01:12:45 | 4 | |
|
pfast NPC1(NTD) Resource Report Resource Website |
RRID:Addgene_25773 | npc1 | Homo sapiens | Ampicillin | PMID:19563754 | There is a TEV cleavage site downstream of His tag. | Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | aa 23-252 only | 2026-08-15 01:12:45 | 0 |
|
pFAST NPC1(NTD)-3Q Resource Report Resource Website |
RRID:Addgene_25772 | npc1 | Homo sapiens | Ampicillin | PMID:19563754 | There is a TEV cleavage site downstream of His tag. | Backbone Marker:invitrogen; Backbone Size:5000; Vector Backbone:pFASTBAC; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | aa23-252 only; N70Q N122Q N185Q | 2026-08-15 01:12:47 | 0 |
|
pGEX-EGFAB(H306Y) Resource Report Resource Website |
RRID:Addgene_25771 | LDL receptor EGFAB | Homo sapiens | Ampicillin | PMID:19224862 | This plasmid was generated in the Deisenhofer lab but first described in J Biol Chem. 2009 Apr 17. 284(16):10561-70. | Backbone Size:5000; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | His 306 to Tyr | 2026-08-15 01:12:45 | 0 |
|
pSIREN-RetroQ-CDK6-shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_25789 | shRNA against human CDK6 | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:45 | 1 | ||
|
LV-CFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_25998 | H2B-CFP | Homo sapiens | Ampicillin | PMID:20526348 | Backbone Size:6406; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:47 | 5 | ||
|
LV-GFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_25999 | H2B-GFP | Homo sapiens | Ampicillin | PMID:20526348 | Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment or SphI-SacII fragment. | Backbone Size:6380; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:50 | 63 | |
|
Venus-Cdc20 R132A (1768) Resource Report Resource Website |
RRID:Addgene_26059 | Cdc20 | Homo sapiens | Kanamycin | PMID:18997788 | EYFP was swapped with Venus using AgeI and BsrGI restriction sites. | Backbone Marker:See note below; Backbone Size:4700; Vector Backbone:pVenus-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Mutation in the Mad2 binding site, R132A | 2026-08-15 01:12:50 | 0 |
|
pMXs-Hu-L-Myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_26022 | L-Myc | Homo sapiens | Ampicillin | PMID:20660764 | Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:6340; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:12:50 | 7 | |
|
pSIN4-EF2-ABCG2-IRES-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_25983 | ATP-binding cassette, sub-family G (WHITE), member 2, variant of isoform 2 | Homo sapiens | Ampicillin | PMID:19670287 | Please note that the backbone of this plasmid is larger than the reported 6.5kb (see attached diagnostic digest). | Backbone Marker:James Thomson; Backbone Size:6500; Vector Backbone:pSIN-EF2-MCS-IRES-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | None | 2026-08-15 01:12:47 | 5 |
|
CD11b promoter in pGEM3zf(-) Resource Report Resource Website 1+ mentions |
RRID:Addgene_26168 | CD11b promoter | Homo sapiens | Ampicillin | PMID:7811988 | The cloned CD11b promoter in this construct contains some 5'UTR, including the transcription start site. | Backbone Marker:Promega; Backbone Size:3199; Vector Backbone:pGEM3zf-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:51 | 2 | |
|
RAB25 Resource Report Resource Website |
RRID:Addgene_26163 | RAB25:HPC038-B06:C25773 | Homo sapiens | Kanamycin | PDB: 2OIL http://www.thesgc.org/structures/2OIL/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:49 | 0 | ||
|
HA-HIF2α P531A-pBabe-puro Resource Report Resource Website |
RRID:Addgene_26091 | Hypoxia inducible factor 2 alpha | Homo sapiens | Ampicillin | PMID:12086860 | Backbone Size:5140; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | cDNA with point mutation P531A | 2026-08-15 01:12:48 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
