Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET His6 High pI protein 69 TEV LIC cloning vector (2-HpI-69) Resource Report Resource Website |
RRID:Addgene_55212 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2-HpI-69 has a TEV-cleavable N-terminal His6-High pI protein fusion tag. The high pI can improve solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 0 | ||||
|
pET His6 High pI protein 68 TEV LIC cloning vector (2-HpI-68) Resource Report Resource Website 1+ mentions |
RRID:Addgene_55211 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2-HpI-68 has a TEV-cleavable N-terminal His6-High pI protein fusion tag. The high pI can improve solubility of your target protein.To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 1 | ||||
|
pFastBac His6 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning (438-B) Resource Report Resource Website 10+ mentions |
RRID:Addgene_55219 | Ampicillin | PMID:28668116 | In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-B has a TEV cleavable His6 at the N-terminus. The 438-B vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 14 | |||
|
pFastBac cloning vector with BioBrick PolyPromoter LIC Subcloning (438-A) Resource Report Resource Website 10+ mentions |
RRID:Addgene_55218 | Ampicillin | PMID:28668116 | In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-A is an untagged pFastBac LIC Subcloning vector. The 438 vectors use the LICvBac Forward primer and the LICv1 Reverse primer. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:18 | 24 | |||
|
pCoofy44 Resource Report Resource Website |
RRID:Addgene_55185 | Ampicillin | PMID:23410102 | C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Life Technologies; Backbone Size:6383; Vector Backbone:pFastBac; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 0 | |||
|
pCoofy41 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55184 | Ampicillin | PMID:23410102 | C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Life Technologies; Backbone Size:6063; Vector Backbone:pFastBac; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 1 | |||
|
pFastBac TEV SNAPf Prescission TwinStrepII cloning vector with BioBrick PolyPromoter LIC Subcloning (438-SNAP-V3) Resource Report Resource Website |
RRID:Addgene_55223 | Ampicillin | PMID:28668116 | In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-SNAP-V3 has a TEV cleavable TwinStrepII-Prescission-SNAPf on the C-terminus. The 438-SNAP-V3 vector use the LICv3 Forward and Reverse primers. LICv3 Forward - 5'-TTTAAGAAGGAGATATAGTTC-3' LICv3 Reverse - 5'-GGATTGGAAGTAGAGGTTCTC-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 0 | |||
|
pFastBac StrepII msfGFP TEV cloning vector with BioBrick PolyPromoter LIC Subcloning (438-Rgfp) Resource Report Resource Website 1+ mentions |
RRID:Addgene_55221 | Ampicillin | PMID:28668116 | In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-Rgfp has a TEV cleavable StrepII and msfGFP at the N-terminus. The 438-Rgfp vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:18 | 6 | |||
|
pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning (438-C) Resource Report Resource Website 10+ mentions |
RRID:Addgene_55220 | Ampicillin | PMID:28668116 | In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-C has a TEV cleavable His6-MBP N10 at the N-terminus. MBP can improve expression and solubility of the target protein. The 438-C vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 25 | |||
|
CMVp-dCas9-3xNLS-VP64 (Construct 1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_55195 | dCas9 | Homo sapiens | Ampicillin | PMID:24837679 | Please see http://www.rle.mit.edu/sbg/resources/ for more information. | Backbone Marker:Sally Temple; Backbone Size:8000; Vector Backbone:pFUGw (Addgene id: 25870); Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 2 | |
|
YFP(159-238)-gamma-12 in pcDNAI/Amp Resource Report Resource Website |
RRID:Addgene_55194 | YFP(159-238)-gamma-12 | Homo sapiens | Ampicillin | PMID:16641313 | Backbone Marker:Invitrogen; Backbone Size:4800; Vector Backbone:pcDNAI/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ggamma-12 was amplified by PCR, which added a BamHI site and a linker sequence (Arg-Ser) to the 5' end and a 3' BglII site. Cloning into the BglII site of YFP(159-238) destroyed the BamHI site. | 2026-08-29 01:07:17 | 0 | |
|
YFP(159-238)-gamma-10 in pcDNAI/Amp Resource Report Resource Website |
RRID:Addgene_55192 | YFP-(159-238)-gamma-10 | Homo sapiens | Ampicillin | PMID:16641313 | Backbone Marker:Invitrogen; Backbone Size:4800; Vector Backbone:pcDNAI/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ggamma-10 was amplified by PCR, which added a BamHI site and a linker sequence (Arg-Ser) to the 5' end and a 3' BglII site. Cloning into the BglII site of YFP(159-238) destroyed the BamHI site. | 2026-08-29 01:07:17 | 0 | |
|
CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA (Construct 22) Resource Report Resource Website |
RRID:Addgene_55199 | ECFP | Homo sapiens | Ampicillin | PMID:24837679 | Please see http://www.rle.mit.edu/sbg/resources/ for more information. | Backbone Size:3500; Vector Backbone:pGL2-Luc (Addgene #26280); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 0 | |
|
pBS2E Resource Report Resource Website 1+ mentions |
RRID:Addgene_55169 | Ampicillin | PMID:24295448 | This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: GGCAACCGAGCGTTCTG rev: CTGACAGCGTTTCGATCC | Backbone Marker:Hartl et al 2001; Vector Backbone:pAX01; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:16 | 1 | |||
|
pBS1C Resource Report Resource Website 1+ mentions |
RRID:Addgene_55168 | Ampicillin | PMID:24295448 | This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: AAAGGTCATTGTTGACGCGG rev: GAGCGTAGCGAAAAATCC | Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:16 | 1 | |||
|
pET His10 MBP Asn10 TEV LIC cloning vector (2CT-10) Resource Report Resource Website 1+ mentions |
RRID:Addgene_55209 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2CT-10 has a TEV-cleavable N-terminal His10-MBP fusion tag followed by Asn10. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:07:17 | 9 | ||||
|
Ai62(TITL-tdT) Flp-in replacement vector Resource Report Resource Website 1+ mentions |
RRID:Addgene_61576 | chromatin insulator flanked TRE-LSL-tdTomato | Synthetic | Ampicillin | PMID:25741722 | Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:16 | 2 | ||
|
DPYD-FLAG Resource Report Resource Website |
RRID:Addgene_61616 | Dihydropyrimidine dehydrogenase | Homo sapiens | Ampicillin | PMID:25171410 | Backbone Size:7347; Vector Backbone:pLJC2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:18 | 0 | ||
|
Pvalb-2A-Flpo Flp-in replacement vector Resource Report Resource Website |
RRID:Addgene_61572 | Pvalb-2A-Flpo | Mus musculus | Ampicillin | PMID:25741722 | Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:17 | 0 | ||
|
Slc17a7-IRES2-Cre targeting vector Resource Report Resource Website 1+ mentions |
RRID:Addgene_61574 | Slc17a7-IRES2-Cre | Mus musculus | Ampicillin | PMID:25741722 | The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination. | Backbone Size:2657; Vector Backbone:minimal cloning vector; Vector Types:Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:18 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
