Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 385 showing 7681 ~ 7700 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_33069

    This resource has 1+ mentions.

http://www.addgene.org/33069

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7800; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20048001
Comments: From Depositor: S128A and S131A are also present due to alanine scanning mutagenesis. However, they are not important and do not alter plasmid function.

Proper citation: RRID:Addgene_33069 Copy   


  • RRID:Addgene_33066

http://www.addgene.org/33066

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33066 Copy   


  • RRID:Addgene_33067

http://www.addgene.org/33067

Genetic Insert: CaYin1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4100; Vector Backbone:pBAD hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22080726

Proper citation: RRID:Addgene_33067 Copy   


  • RRID:Addgene_33061

http://www.addgene.org/33061

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33061 Copy   


  • RRID:Addgene_33059

http://www.addgene.org/33059

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33059 Copy   


http://www.addgene.org/33053

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:PGEX-KG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33053 Copy   


  • RRID:Addgene_33042

http://www.addgene.org/33042

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33042 Copy   


  • RRID:Addgene_33043

http://www.addgene.org/33043

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33043 Copy   


http://www.addgene.org/33036

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33036 Copy   


http://www.addgene.org/33034

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33034 Copy   


http://www.addgene.org/33037

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33037 Copy   


http://www.addgene.org/33038

Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905

Proper citation: RRID:Addgene_33038 Copy   


  • RRID:Addgene_33143

    This resource has 1+ mentions.

http://www.addgene.org/33143

Species: E. coli
Genetic Insert: LacO (256 copies)
Vector Backbone Description: Vector Backbone:Ylplac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18614049
Comments: Addgene cannot verify or guarantee the presence of all 256 copies of LacO. This element is unstable. For use in two-plasmid-based gene-nuclear periphery tethering assay with either plasmids pAK67 (Addgene #33142). pVS2 (Addgene #33144) contains 256 LacO repeats and a GAL-GFP-GALpA-reporter gene (pVS1 is identical but does not contain the reporter gene). The reporter was previously characterized and contains a GFP open reading frame flanked by the GAL1 promoter and GAL1 3′ UTR ([Abruzzi et al., 2006] and [Dower et al., 2004]). pKA67 expresses both LacI-GFP and Nup49-GFP to mark the first plasmid as well as the nuclear periphery with GFP.

Proper citation: RRID:Addgene_33143 Copy   


  • RRID:Addgene_33149

http://www.addgene.org/33149

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33149 Copy   


  • RRID:Addgene_33148

http://www.addgene.org/33148

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33148 Copy   


http://www.addgene.org/33255

Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"

Proper citation: RRID:Addgene_33255 Copy   


http://www.addgene.org/33254

Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"

Proper citation: RRID:Addgene_33254 Copy   


  • RRID:Addgene_33252

    This resource has 1+ mentions.

http://www.addgene.org/33252

Species: Homo sapiens
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152

Proper citation: RRID:Addgene_33252 Copy   


  • RRID:Addgene_33198

http://www.addgene.org/33198

Species: Caenorhabditis elegans
Genetic Insert: T04C9.2 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33198 Copy   


  • RRID:Addgene_33232

http://www.addgene.org/33232

Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034

Proper citation: RRID:Addgene_33232 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X