Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pQCXIH-Flag-YAP-S127/381A Resource Report Resource Website 1+ mentions |
RRID:Addgene_33069 | YAP | Homo sapiens | Ampicillin | PMID:20048001 | From Depositor: S128A and S131A are also present due to alanine scanning mutagenesis. However, they are not important and do not alter plasmid function. | Backbone Marker:Clontech; Backbone Size:7800; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | S127A, S381A | 2026-08-15 01:13:46 | 2 |
|
pCMV-Flag-YAP-F95A Resource Report Resource Website |
RRID:Addgene_33066 | YAP | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | F95A | 2026-08-15 01:13:46 | 0 | |
|
CaYin1 Resource Report Resource Website |
RRID:Addgene_33067 | CaYin1 | Ampicillin | PMID:22080726 | Backbone Marker:invitrogen; Backbone Size:4100; Vector Backbone:pBAD hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:52 | 0 | |||
|
pCMV-Flag-YAP-R58A Resource Report Resource Website |
RRID:Addgene_33061 | YAP | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R58A | 2026-08-15 01:13:52 | 0 | |
|
pCMV-Flag-YAP-L68A Resource Report Resource Website |
RRID:Addgene_33059 | YAP | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L68A | 2026-08-15 01:13:46 | 0 | |
|
pGEX-KG-GST-YAP-S127A Resource Report Resource Website |
RRID:Addgene_33053 | YAP | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:5000; Vector Backbone:PGEX-KG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S127A | 2026-08-15 01:13:46 | 0 | |
|
pRK5-Myc-TEAD1-E205K Resource Report Resource Website |
RRID:Addgene_33042 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E205K | 2026-08-15 01:13:51 | 0 | |
|
pRK5-Myc-TEAD1-D278K Resource Report Resource Website |
RRID:Addgene_33043 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D278K | 2026-08-15 01:13:46 | 0 | |
|
pCMX-Gal4-TEAD1-I247A Resource Report Resource Website |
RRID:Addgene_33036 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I247A | 2026-08-15 01:13:46 | 0 | |
|
pCMX-Gal4-TEAD1-Y406A Resource Report Resource Website |
RRID:Addgene_33034 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Y406A | 2026-08-15 01:13:51 | 0 | |
|
pCMX-Gal4-TEAD1-L272A Resource Report Resource Website |
RRID:Addgene_33037 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L272A | 2026-08-15 01:13:51 | 0 | |
|
pCMX-Gal4-TEAD1-V391A Resource Report Resource Website |
RRID:Addgene_33038 | TEAD1 | Homo sapiens | Ampicillin | PMID:20123905 | Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | V391A | 2026-08-15 01:13:46 | 0 | |
|
pVS1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_33143 | LacO (256 copies) | E. coli | Ampicillin | PMID:18614049 | Addgene cannot verify or guarantee the presence of all 256 copies of LacO. This element is unstable. For use in two-plasmid-based gene-nuclear periphery tethering assay with either plasmids pAK67 (Addgene #33142). pVS2 (Addgene #33144) contains 256 LacO repeats and a GAL-GFP-GALpA-reporter gene (pVS1 is identical but does not contain the reporter gene). The reporter was previously characterized and contains a GFP open reading frame flanked by the GAL1 promoter and GAL1 3′ UTR ([Abruzzi et al., 2006] and [Dower et al., 2004]). pKA67 expresses both LacI-GFP and Nup49-GFP to mark the first plasmid as well as the nuclear periphery with GFP. | Vector Backbone:Ylplac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:47 | 2 | |
|
pLG-Sty Resource Report Resource Website |
RRID:Addgene_33149 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG | 2026-08-15 01:13:47 | 0 |
|
pLG-Acc Resource Report Resource Website |
RRID:Addgene_33148 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC | 2026-08-15 01:13:47 | 0 |
|
pBabe puro-HA-PIK3CA(H1047R;F486S;del) Resource Report Resource Website |
RRID:Addgene_33255 | PIK3CA | Homo sapiens | Ampicillin | PMID:21876152 | Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein" | Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed histidine 1047 to arginine and phenylalanine 486 to serine; deleted amino acids 343-346 | 2026-08-15 01:13:54 | 0 |
|
pBabe puro-HA-PIK3CA(H1047R;G320E) Resource Report Resource Website |
RRID:Addgene_33254 | PIK3CA | Homo sapiens | Ampicillin | PMID:21876152 | Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein" | Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed histidine 1047 to arginine and glycine 320 to glutamic acid | 2026-08-15 01:13:48 | 0 |
|
pBabe puro-eIF4E Resource Report Resource Website 1+ mentions |
RRID:Addgene_33252 | eIF4E | Homo sapiens | Ampicillin | PMID:21876152 | Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | unmodified | 2026-08-15 01:13:54 | 2 | |
|
pDMG14b Resource Report Resource Website |
RRID:Addgene_33198 | T04C9.2 3'UTR | Caenorhabditis elegans | Ampicillin | PMID:21909094 | Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | miR-142 site: aCacTaC | 2026-08-15 01:13:47 | 0 | |
|
Gal-Rad51 KR Resource Report Resource Website |
RRID:Addgene_33232 | Rad51 | Saccharomyces cerevisiae | Ampicillin | PMID:20864034 | Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | K191R | 2026-08-15 01:13:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.