Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,321 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pQCXIH-Flag-YAP-S127/381A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33069 YAP Homo sapiens Ampicillin PMID:20048001 From Depositor: S128A and S131A are also present due to alanine scanning mutagenesis. However, they are not important and do not alter plasmid function. Backbone Marker:Clontech; Backbone Size:7800; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S127A, S381A 2026-08-15 01:13:46 2
pCMV-Flag-YAP-F95A
 
Resource Report
Resource Website 		RRID:Addgene_33066 YAP Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin F95A 2026-08-15 01:13:46 0
CaYin1
 
Resource Report
Resource Website 		RRID:Addgene_33067 CaYin1 Ampicillin PMID:22080726 Backbone Marker:invitrogen; Backbone Size:4100; Vector Backbone:pBAD hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:52 0
pCMV-Flag-YAP-R58A
 
Resource Report
Resource Website 		RRID:Addgene_33061 YAP Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R58A 2026-08-15 01:13:52 0
pCMV-Flag-YAP-L68A
 
Resource Report
Resource Website 		RRID:Addgene_33059 YAP Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L68A 2026-08-15 01:13:46 0
pGEX-KG-GST-YAP-S127A
 
Resource Report
Resource Website 		RRID:Addgene_33053 YAP Homo sapiens Ampicillin PMID:20123905 Backbone Size:5000; Vector Backbone:PGEX-KG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S127A 2026-08-15 01:13:46 0
pRK5-Myc-TEAD1-E205K
 
Resource Report
Resource Website 		RRID:Addgene_33042 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E205K 2026-08-15 01:13:51 0
pRK5-Myc-TEAD1-D278K
 
Resource Report
Resource Website 		RRID:Addgene_33043 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D278K 2026-08-15 01:13:46 0
pCMX-Gal4-TEAD1-I247A
 
Resource Report
Resource Website 		RRID:Addgene_33036 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I247A 2026-08-15 01:13:46 0
pCMX-Gal4-TEAD1-Y406A
 
Resource Report
Resource Website 		RRID:Addgene_33034 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y406A 2026-08-15 01:13:51 0
pCMX-Gal4-TEAD1-L272A
 
Resource Report
Resource Website 		RRID:Addgene_33037 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L272A 2026-08-15 01:13:51 0
pCMX-Gal4-TEAD1-V391A
 
Resource Report
Resource Website 		RRID:Addgene_33038 TEAD1 Homo sapiens Ampicillin PMID:20123905 Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin V391A 2026-08-15 01:13:46 0
pVS1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33143 LacO (256 copies) E. coli Ampicillin PMID:18614049 Addgene cannot verify or guarantee the presence of all 256 copies of LacO. This element is unstable. For use in two-plasmid-based gene-nuclear periphery tethering assay with either plasmids pAK67 (Addgene #33142). pVS2 (Addgene #33144) contains 256 LacO repeats and a GAL-GFP-GALpA-reporter gene (pVS1 is identical but does not contain the reporter gene). The reporter was previously characterized and contains a GFP open reading frame flanked by the GAL1 promoter and GAL1 3′ UTR ([Abruzzi et al., 2006] and [Dower et al., 2004]). pKA67 expresses both LacI-GFP and Nup49-GFP to mark the first plasmid as well as the nuclear periphery with GFP. Vector Backbone:Ylplac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:47 2
pLG-Sty
 
Resource Report
Resource Website 		RRID:Addgene_33149 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG 2026-08-15 01:13:47 0
pLG-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33148 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC 2026-08-15 01:13:47 0
pBabe puro-HA-PIK3CA(H1047R;F486S;del)
 
Resource Report
Resource Website 		RRID:Addgene_33255 PIK3CA Homo sapiens Ampicillin PMID:21876152 Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein" Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin changed histidine 1047 to arginine and phenylalanine 486 to serine; deleted amino acids 343-346 2026-08-15 01:13:54 0
pBabe puro-HA-PIK3CA(H1047R;G320E)
 
Resource Report
Resource Website 		RRID:Addgene_33254 PIK3CA Homo sapiens Ampicillin PMID:21876152 Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein" Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin changed histidine 1047 to arginine and glycine 320 to glutamic acid 2026-08-15 01:13:48 0
pBabe puro-eIF4E
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33252 eIF4E Homo sapiens Ampicillin PMID:21876152 Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin unmodified 2026-08-15 01:13:54 2
pDMG14b
 
Resource Report
Resource Website 		RRID:Addgene_33198 T04C9.2 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-142 site: aCacTaC 2026-08-15 01:13:47 0
Gal-Rad51 KR
 
Resource Report
Resource Website 		RRID:Addgene_33232 Rad51 Saccharomyces cerevisiae Ampicillin PMID:20864034 Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin K191R 2026-08-15 01:13:47 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch