Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7800; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20048001
Comments: From Depositor: S128A and S131A are also present due to alanine scanning mutagenesis. However, they are not important and do not alter plasmid function.
Proper citation: RRID:Addgene_33069 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33066 Copy
Genetic Insert: CaYin1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4100; Vector Backbone:pBAD hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22080726
Proper citation: RRID:Addgene_33067 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33061 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33059 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:PGEX-KG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33053 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33042 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33043 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33036 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33034 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33037 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20123905
Proper citation: RRID:Addgene_33038 Copy
Species: E. coli
Genetic Insert: LacO (256 copies)
Vector Backbone Description: Vector Backbone:Ylplac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18614049
Comments: Addgene cannot verify or guarantee the presence of all 256 copies of LacO. This element is unstable.
For use in two-plasmid-based gene-nuclear periphery tethering assay with either plasmids pAK67 (Addgene #33142).
pVS2 (Addgene #33144) contains 256 LacO repeats and a GAL-GFP-GALpA-reporter gene (pVS1 is identical but does not contain the reporter gene). The reporter was previously characterized and contains a GFP open reading frame flanked by the GAL1 promoter and GAL1 3′ UTR ([Abruzzi et al., 2006] and [Dower et al., 2004]).
pKA67 expresses both LacI-GFP and Nup49-GFP to mark the first plasmid as well as the nuclear periphery with GFP.
Proper citation: RRID:Addgene_33143 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33149 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33148 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"
Proper citation: RRID:Addgene_33255 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"
Proper citation: RRID:Addgene_33254 Copy
Species: Homo sapiens
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21876152
Proper citation: RRID:Addgene_33252 Copy
Species: Caenorhabditis elegans
Genetic Insert: T04C9.2 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094
Proper citation: RRID:Addgene_33198 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034
Proper citation: RRID:Addgene_33232 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
