Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Androgen receptor (AR)
Vector Backbone Description: Backbone Marker:Clontech (Takara); Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27699828
Comments: The poly-glutamine repeat region in this plasmid is known to be unstable and the exact number of repeats may vary. However, repeats of 18-26 glutamines are all considered wildtype. Screen multiple colonies to ensure isolation of a plasmid with a suitable number of repeats.
Prostate. 2013 February 15; 73(3): 267–277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated
by FOXO1 in a PTEN-PI3K-AKT-dependent way.
Cloning is described in the supplemental materials (excerpted below).
Cloning Strategy
The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5’-GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.
Proper citation: RRID:Addgene_86856 Copy
Species: Mus musculus
Genetic Insert: miRFP680-Actin-C-18
Vector Backbone Description: Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197219 Copy
Species: Homo sapiens
Genetic Insert: PCMV::LAMP1::miniSOG::mCherry
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36870997
Proper citation: RRID:Addgene_198147 Copy
Species: Methanomethylophilus alvus
Genetic Insert: M. alvus PylRS WT
Vector Backbone Description: Vector Backbone:pBK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36383641
Comments: This plasmid only expresses the M. alvus Pyl tRNA synthetase and is used specifically for synthetase selections. It does not co-express the cognate Ma Pyl-tRNA. Libraries of Pyl-RS mutants can be built on this plasmid, and then paired with the M. alvus positive selection plasmid (197571), negative selection plasmid (197572) or fluorescence reporter plasmid (197574). This plasmid cannot be paired with with traditional E. coli expression vectors (e.g. pET, pBAD) for incorporation of non-canonical amino acids since it lacks expression of the cognate Pyl-tRNA and origin of replication compatibility issues.
Proper citation: RRID:Addgene_197573 Copy
Species: Mus musculus
Genetic Insert: H2B-miRFP670-2
Vector Backbone Description: Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197228 Copy
Species: Mus musculus
Genetic Insert: H2B-iRFP670
Vector Backbone Description: Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197227 Copy
Species: Mus musculus
Genetic Insert: Cx43-7-miRFP713
Vector Backbone Description: Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37666982
Comments: Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint.
Proper citation: RRID:Addgene_197225 Copy
Species: Homo sapiens
Genetic Insert: PTPN22
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26631741
Proper citation: RRID:Addgene_195377 Copy
Species: Homo sapiens
Genetic Insert: PTPN22
Vector Backbone Description: Vector Backbone:pCMV-Tag2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_195386 Copy
Species: Synthetic
Genetic Insert: eGFP-silicatein
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_198012 Copy
Genetic Insert: SARS-CoV-2-RBD-XBB.1.5
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35609088
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.12.29.474491v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_198466 Copy
Genetic Insert: SARS-CoV-2-S2P-XBB.1.5
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35609088
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.12.29.474491v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_198465 Copy
Species: Homo sapiens
Genetic Insert: SNAPf
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38012391
Comments: Please visit https://doi.org/10.1101/2023.01.31.526423 for bioRxiv preprint.
Proper citation: RRID:Addgene_197497 Copy
Species: Homo sapiens
Genetic Insert: SNAPf
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38012391
Comments: Please visit https://doi.org/10.1101/2023.01.31.526423 for bioRxiv preprint.
Proper citation: RRID:Addgene_197496 Copy
Species: Homo sapiens
Genetic Insert: UBASH3A
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31659016
Proper citation: RRID:Addgene_195402 Copy
Species: Synthetic
Genetic Insert: HaloTag
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:5810; Vector Backbone:TfR-sfGFP-myc tag-SpyCatcher003 Sequences; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36608338
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.10.04.510821v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_195347 Copy
Species: Homo sapiens
Genetic Insert: ATG9A
Vector Backbone Description: Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29698489
Proper citation: RRID:Addgene_197393 Copy
Species: Homo sapiens
Genetic Insert: MYO10
Vector Backbone Description: Vector Backbone:EGFPC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36861887
Comments: The GFP-MYO10-BioID construct was generated as follows. Flanking XbaI sites were introduced into BioID by PCR (5’-ATTAGATCTAGAGGATCCAAGGACAACACCGTGCCCCTG, 5’-ATTAGATCTAGACTATGCGTAATCCGGTACATCGTAA, template plasmid: BioID pcDNA3.1 MCS-BirA(R118G)-HA) (Addgene plasmid # 36047) and the resulting amplicon was then inserted into a unique XbaI site in the EGFPC1-hMyoX plasmid (Addgene plasmid # 47608) resulting in an EGFP-MYO10-(stop codon)-BioID fusion gene. The stop codon between MYO10 and BioID was then replaced with a codon encoding valine (GTA) using a quick-change mutagenesis kit from Agilent and following the manufacturers' instructions.
Proper citation: RRID:Addgene_194858 Copy
Species: Homo sapiens
Genetic Insert: SENP3 catalytic domain
Vector Backbone Description: Vector Backbone:pGTVL2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_196357 Copy
Species: Homo sapiens
Genetic Insert: SNAPf
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38012391
Comments: Please visit https://doi.org/10.1101/2023.01.31.526423 for bioRxiv preprint.
Proper citation: RRID:Addgene_197498 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
