Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19371381
Proper citation: RRID:Addgene_21126 Copy
Species: Homo sapiens
Genetic Insert: von Hippel-Lindau tumor suppressor
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7800; Vector Backbone:pESC-LEU; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18756251
Proper citation: RRID:Addgene_21053 Copy
Species: Homo sapiens
Genetic Insert: miR-17-92 cluster
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15944709
Proper citation: RRID:Addgene_21109 Copy
Species: Rattus norvegicus
Genetic Insert: Epsin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18689690
Proper citation: RRID:Addgene_21066 Copy
Species: Homo sapiens
Genetic Insert: RNAi against hypoxia inducible factor 1alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:PBS/U6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19131628
Comments: HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA
Proper citation: RRID:Addgene_21103 Copy
Species: Gallus gallus
Genetic Insert: FAK
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21155 Copy
Species: Homo sapiens
Genetic Insert: pcDNA3-HA-Sumo1
Vector Backbone Description: Vector Backbone:pcDNA3.1 HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15117942
Comments: This plasmid does not contain the BGH polyA terminator present in the standard pcDNA3 backbone. It is not known whether the removal of the terminator affects expression.
Proper citation: RRID:Addgene_21154 Copy
Genetic Insert: HA-Q79-GFP
Vector Backbone Description: Backbone Size:0; Vector Backbone:PEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12540902
Proper citation: RRID:Addgene_21159 Copy
Species: Homo sapiens
Genetic Insert: PcDNA3-Beclin1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16522639
Proper citation: RRID:Addgene_21150 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384
Proper citation: RRID:Addgene_21208 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384
Comments: Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.
Proper citation: RRID:Addgene_21207 Copy
Species: Homo sapiens
Genetic Insert: miR-17-5p Control
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5523; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15944709
Proper citation: RRID:Addgene_21166 Copy
Species: Rattus norvegicus
Genetic Insert: PKC gamma
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4724; Vector Backbone:N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9456311
Proper citation: RRID:Addgene_21204 Copy
Species: Homo sapiens
Genetic Insert: pBabePuro-bcl 2
Vector Backbone Description: Backbone Size:5035; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8242741
Proper citation: RRID:Addgene_21144 Copy
Species: Homo sapiens
Genetic Insert: PKC alpha
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12794082
Proper citation: RRID:Addgene_21233 Copy
Species: Homo sapiens
Genetic Insert: EsR1- HRas
Vector Backbone Description: Backbone Size:11100; Vector Backbone:LZRS no LacZ; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11896581
Proper citation: RRID:Addgene_21199 Copy
Species: Mus musculus
Genetic Insert: PKC gamma
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12794082
Proper citation: RRID:Addgene_21236 Copy
Species: Homo sapiens
Genetic Insert: PKC alpha
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12794082
Proper citation: RRID:Addgene_21235 Copy
Species: Homo sapiens
Genetic Insert: Mek2
Vector Backbone Description: Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21191 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21196 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.