Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 386 showing 7701 ~ 7720 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_26358

    This resource has 1+ mentions.

http://www.addgene.org/26358

Species: Homo sapiens
Genetic Insert: lin-28 homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe.puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19483683

Proper citation: RRID:Addgene_26358 Copy   


  • RRID:Addgene_26353

    This resource has 1+ mentions.

http://www.addgene.org/26353

Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA

Proper citation: RRID:Addgene_26353 Copy   


  • RRID:Addgene_26352

    This resource has 1+ mentions.

http://www.addgene.org/26352

Species: Homo sapiens
Genetic Insert: Sox2 shRNA
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978
Comments: SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT

Proper citation: RRID:Addgene_26352 Copy   


  • RRID:Addgene_26351

    This resource has 1+ mentions.

http://www.addgene.org/26351

Species: Homo sapiens
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pWZL Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978

Proper citation: RRID:Addgene_26351 Copy   


  • RRID:Addgene_26350

http://www.addgene.org/26350

Species: Homo sapiens
Genetic Insert: FOXE1
Vector Backbone Description: Backbone Marker:Addgene Plasmid 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19801978

Proper citation: RRID:Addgene_26350 Copy   


  • RRID:Addgene_26529

    This resource has 1+ mentions.

http://www.addgene.org/26529

Species: Homo sapiens
Genetic Insert: miR-155
Vector Backbone Description: Backbone Marker:Addgene plasmid 12282; Backbone Size:6500; Vector Backbone:pMIG-w; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18299402
Comments: MG155 was derived originally from pMIG-w. The GFP and IRES were removed using BglII and HindIII, and a new cassette with eGFP (about 700 bps) followed by a miR-155 sequence (about 500 bps with flanking Not1 and XhoI sites) was cloned in using BamHI (destroying the BglII site) and HindIII. This results in a 7 kb plasmid.

Proper citation: RRID:Addgene_26529 Copy   


http://www.addgene.org/26532

Species: Homo sapiens
Genetic Insert: IL7
Vector Backbone Description: Backbone Size:7707; Vector Backbone:pUC18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_26532 Copy   


  • RRID:Addgene_26461

    This resource has 1+ mentions.

http://www.addgene.org/26461

Species: Homo sapiens
Genetic Insert: PCNA
Vector Backbone Description: Backbone Size:6037; Vector Backbone:pIRES-puro2b; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20693996
Comments: Note that there are a few minor discrepancies between Addgene's quality control sequence and the author's sequence, but these should not affect function.

Proper citation: RRID:Addgene_26461 Copy   


  • RRID:Addgene_26607

    This resource has 1+ mentions.

http://www.addgene.org/26607

Species: Homo sapiens
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627

Proper citation: RRID:Addgene_26607 Copy   


http://www.addgene.org/26606

Species: Homo sapiens
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627

Proper citation: RRID:Addgene_26606 Copy   


  • RRID:Addgene_26608

http://www.addgene.org/26608

Species: Homo sapiens
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627

Proper citation: RRID:Addgene_26608 Copy   


  • RRID:Addgene_26603

    This resource has 10+ mentions.

http://www.addgene.org/26603

Species: Homo sapiens
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627

Proper citation: RRID:Addgene_26603 Copy   


  • RRID:Addgene_26566

    This resource has 1+ mentions.

http://www.addgene.org/26566

Species: Homo sapiens
Genetic Insert: PP1a
Vector Backbone Description: Backbone Marker:Peti Lab (Addgene #26563); Backbone Size:0; Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18992256
Comments: The backbone is a modified version of pET28 and is also available at Addgene (plasmid #26563)

Proper citation: RRID:Addgene_26566 Copy   


  • RRID:Addgene_26642

http://www.addgene.org/26642

Species: Homo sapiens
Genetic Insert: Apoptotic protease activating factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630894

Proper citation: RRID:Addgene_26642 Copy   


http://www.addgene.org/26625

Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-CCTCAGACATACTCCATAGAT-3'.

Proper citation: RRID:Addgene_26625 Copy   


  • RRID:Addgene_26627

http://www.addgene.org/26627

Species: Homo sapiens
Genetic Insert: RagB shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against RagB. Target sequence: 5'-CGGGACAACATCTTCCGAAAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.

Proper citation: RRID:Addgene_26627 Copy   


http://www.addgene.org/26626

Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'.

Proper citation: RRID:Addgene_26626 Copy   


  • RRID:Addgene_26631

http://www.addgene.org/26631

Species: Homo sapiens
Genetic Insert: p18 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20381137
Comments: shRNA directed against p18. Target sequence: 5'-AGACAGCCAGCAACATCATTG-3'

Proper citation: RRID:Addgene_26631 Copy   


  • RRID:Addgene_26633

    This resource has 1+ mentions.

http://www.addgene.org/26633

Species: Homo sapiens
Genetic Insert: raptor
Vector Backbone Description: Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20381137

Proper citation: RRID:Addgene_26633 Copy   


  • RRID:Addgene_26596

    This resource has 10+ mentions.

http://www.addgene.org/26596

Species: Homo sapiens
Genetic Insert: STAT3 shRNA
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20197401
Comments: STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg

Proper citation: RRID:Addgene_26596 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X