Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBABE-hLin28B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26358 lin-28 homolog B Homo sapiens Ampicillin PMID:19483683 Backbone Size:5169; Vector Backbone:pBabe.puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:12:52 4
pLKO.1 Sox2 HM a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26353 Sox2 shRNA Homo sapiens Ampicillin PMID:19801978 SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:52 8
pLKO.1 Sox2 3H b
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26352 Sox2 shRNA Homo sapiens Ampicillin PMID:19801978 SOX2b shRNA sequence - CTGCCGAGAATCCATGTATAT Backbone Size:0; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:51 3
pWZL Sox2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26351 Sox2 Homo sapiens Ampicillin PMID:19801978 Backbone Size:0; Vector Backbone:pWZL Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:51 1
pBABE FoxE1
 
Resource Report
Resource Website 		RRID:Addgene_26350 FOXE1 Homo sapiens Ampicillin PMID:19801978 Backbone Marker:Addgene Plasmid 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:52 0
MG-155
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26529 miR-155 Homo sapiens Ampicillin PMID:18299402 MG155 was derived originally from pMIG-w. The GFP and IRES were removed using BglII and HindIII, and a new cassette with eGFP (about 700 bps) followed by a miR-155 sequence (about 500 bps with flanking Not1 and XhoI sites) was cloned in using BamHI (destroying the BglII site) and HindIII. This results in a 7 kb plasmid. Backbone Marker:Addgene plasmid 12282; Backbone Size:6500; Vector Backbone:pMIG-w; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:53 2
pHAGE-CMV-hIL7-IRES-ZsGreen-W
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26532 IL7 Homo sapiens Ampicillin Backbone Size:7707; Vector Backbone:pUC18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:53 6
pEGFP-PCNA-IRES-puro2b
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26461 PCNA Homo sapiens Ampicillin PMID:20693996 Note that there are a few minor discrepancies between Addgene's quality control sequence and the author's sequence, but these should not affect function. Backbone Size:6037; Vector Backbone:pIRES-puro2b; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:52 7
pGEX-2T FRB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26607 mTOR Homo sapiens Ampicillin PMID:9933627 Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin FRB domain only (aa 2015-2114) 2026-08-15 01:12:54 1
pcDNA3-Flag mTOR S2035T R2109A
 
Resource Report
Resource Website 		RRID:Addgene_26606 mTOR Homo sapiens Ampicillin PMID:9933627 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S2035T R2109A 2026-08-15 01:12:54 0
pGEX-2T FRB S2035I
 
Resource Report
Resource Website 		RRID:Addgene_26608 mTOR Homo sapiens Ampicillin PMID:9933627 Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin FRB domain only (aa 2015-2114); S2035I 2026-08-15 01:12:54 0
pcDNA3-Flag mTOR wt
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26603 mTOR Homo sapiens Ampicillin PMID:9933627 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 39
PP1 7-300
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26566 PP1a Homo sapiens Kanamycin PMID:18992256 The backbone is a modified version of pET28 and is also available at Addgene (plasmid #26563) Backbone Marker:Peti Lab (Addgene #26563); Backbone Size:0; Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Contains only aa 7-330 2026-08-15 01:12:54 7
pET21b Apaf1 1-591
 
Resource Report
Resource Website 		RRID:Addgene_26642 Apoptotic protease activating factor 1 Homo sapiens Ampicillin PMID:16630894 Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Amino Acids 1-591 2026-08-15 01:12:55 0
pLKO.1 Rheb1 shRNA #1
 
Resource Report
Resource Website 		RRID:Addgene_26625 Rheb1 shRNA Homo sapiens Ampicillin PMID:18497260 shRNA directed against Rheb1. Target sequence: 5'-CCTCAGACATACTCCATAGAT-3'. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 0
pLKO.1 RagB shRNA #1
 
Resource Report
Resource Website 		RRID:Addgene_26627 RagB shRNA Homo sapiens Ampicillin PMID:18497260 shRNA directed against RagB. Target sequence: 5'-CGGGACAACATCTTCCGAAAT-3'. Sequence from the website of the RNAi consortium at the Broad institute. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 0
pLKO.1 Rheb1 shRNA #2
 
Resource Report
Resource Website 		RRID:Addgene_26626 Rheb1 shRNA Homo sapiens Ampicillin PMID:18497260 shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 0
pLKO.1 p18 shRNA
 
Resource Report
Resource Website 		RRID:Addgene_26631 p18 shRNA Homo sapiens Ampicillin PMID:20381137 shRNA directed against p18. Target sequence: 5'-AGACAGCCAGCAACATCATTG-3' Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 0
pLJM1 Flag Raptor
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26633 raptor Homo sapiens Ampicillin PMID:20381137 Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 9
pSIH1-puro-STAT3 shRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26596 STAT3 shRNA Homo sapiens Ampicillin PMID:20197401 STAT3 shRNA sequence: gatccGCATCTGCCTAGATCGGCTATTCAAGAGATAGCCGATCTAGGCAGATGTTTTTTg Backbone Marker:System Biosciences; Backbone Size:7200; Vector Backbone:pSIH1-H1-puro; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:54 16

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch