Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 387 showing 7721 ~ 7740 out of 740,321 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_33170

http://www.addgene.org/33170

Species: Caenorhabditis elegans
Genetic Insert: nsy-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33170 Copy   

    • RRID:Addgene_33175

http://www.addgene.org/33175

Species: Caenorhabditis elegans
Genetic Insert: fkh-8 3' UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33175 Copy   

    • RRID:Addgene_33172

http://www.addgene.org/33172

Species: Caenorhabditis elegans
Genetic Insert: nsy-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33172 Copy   

    • RRID:Addgene_33173

http://www.addgene.org/33173

Species: Caenorhabditis elegans
Genetic Insert: fkh-8 3' UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33173 Copy   

    • RRID:Addgene_33219

http://www.addgene.org/33219

Species: Caenorhabditis elegans
Genetic Insert: cog-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33219 Copy   

    • RRID:Addgene_33217

http://www.addgene.org/33217

Species: Caenorhabditis elegans
Genetic Insert: cog-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33217 Copy   

    • RRID:Addgene_33167

http://www.addgene.org/33167

Species: Caenorhabditis elegans
Genetic Insert: ptp-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33167 Copy   

    • RRID:Addgene_33168

http://www.addgene.org/33168

Species: Caenorhabditis elegans
Genetic Insert: ptp-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33168 Copy   

    • RRID:Addgene_33201

http://www.addgene.org/33201

Species: Homo sapiens
Genetic Insert: LRIG1
Vector Backbone Description: Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33201 Copy   

    • RRID:Addgene_33165

http://www.addgene.org/33165

Species: Caenorhabditis elegans
Genetic Insert: F55G1.12 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33165 Copy   

    • RRID:Addgene_33166

http://www.addgene.org/33166

Species: Caenorhabditis elegans
Genetic Insert: F55G1.12 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33166 Copy   

    • RRID:Addgene_33208

http://www.addgene.org/33208

Species: Homo sapiens
Genetic Insert: RAP1A
Vector Backbone Description: Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33208 Copy   

    • RRID:Addgene_33207

http://www.addgene.org/33207

Species: Homo sapiens
Genetic Insert: MAP4K4 3'UTR
Vector Backbone Description: Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33207 Copy   

    • RRID:Addgene_33156

    This resource has 1+ mentions.

http://www.addgene.org/33156

Species: Drosophila melanogaster
Genetic Insert: Cyc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His A; Vector Types:Insect Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18494558

Proper citation: RRID:Addgene_33156 Copy   

    • RRID:Addgene_33154

http://www.addgene.org/33154

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17578907

Proper citation: RRID:Addgene_33154 Copy   

    • RRID:Addgene_33159

http://www.addgene.org/33159

Species: Caenorhabditis elegans
Genetic Insert: cog-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33159 Copy   

    • RRID:Addgene_33273

http://www.addgene.org/33273

Species: Mus musculus
Genetic Insert: GLIS1, Gateway casette A
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura; Backbone Size:4700; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21654807

Proper citation: RRID:Addgene_33273 Copy   

    • RRID:Addgene_33153

    This resource has 1+ mentions.

http://www.addgene.org/33153

Species: Drosophila melanogaster
Genetic Insert: CLK
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11158307

Proper citation: RRID:Addgene_33153 Copy   

    • RRID:Addgene_33150

http://www.addgene.org/33150

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33150 Copy   

    • RRID:Addgene_33151

http://www.addgene.org/33151

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33151 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch