Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Gata 6
Vector Backbone Description: Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26877223
Proper citation: RRID:Addgene_72694 Copy
Species: Mus musculus
Genetic Insert: Mesp 2
Vector Backbone Description: Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26877223
Proper citation: RRID:Addgene_72693 Copy
Species: Mus musculus
Genetic Insert: PACSIN1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRK5; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918399
Proper citation: RRID:Addgene_72577 Copy
Species: Mus musculus
Genetic Insert: PACSIN1
Vector Backbone Description: Backbone Marker:Oligoengine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918399
Proper citation: RRID:Addgene_72576 Copy
Species: Mus musculus
Genetic Insert: Dub3 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10[luc]; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24695638
Comments: Addgene NGS found a small number of single nucleotide discrepancies relative to Sanger sequencing results provided by the depositing laboratory. These do not affect plasmid function
Proper citation: RRID:Addgene_72684 Copy
Species: Mus musculus
Genetic Insert: Dub3
Vector Backbone Description: Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24207026
Comments: Addgene Sanger sequencing detected an S4A mutation within the Dub3 translation that should not affect protein function
Proper citation: RRID:Addgene_72682 Copy
Species: Mus musculus
Genetic Insert: Tbx 5
Vector Backbone Description: Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26877223
Proper citation: RRID:Addgene_72688 Copy
Species: Mus musculus
Genetic Insert: Nkx 2.5
Vector Backbone Description: Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26877223
Proper citation: RRID:Addgene_72689 Copy
Species: Mus musculus
Genetic Insert: ZFP809
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19270682
Proper citation: RRID:Addgene_67788 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9707565
Comments: Mutations G299S, and T305S have no functional consequences.
Proper citation: RRID:Addgene_67836 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11287616
Comments: Mutations G299S, T305S have no functional consequences.
Proper citation: RRID:Addgene_67837 Copy
Species: Mus musculus
Genetic Insert: EKLF
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25197097
Comments: Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences.
Proper citation: RRID:Addgene_67833 Copy
Species: Mus musculus
Genetic Insert: AAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC; Vector Types:Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26094607
Comments: this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.
transgene expression is Cre-dependent; contains flex switch
All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.
The insert was read using primers in the dsred sequence:
dsred 410: CGTAATGCAGAAGAAGACTATG
dsred 530R: CCATGTAGATGGACTTGAACTC
Proper citation: RRID:Addgene_67845 Copy
Species: Mus musculus
Genetic Insert: Cav3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10385524
Proper citation: RRID:Addgene_67886 Copy
Species: Mus musculus
Genetic Insert: Vinculin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25065757
Proper citation: RRID:Addgene_67935 Copy
Species: Mus musculus
Genetic Insert: YC3.60
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26435194
Proper citation: RRID:Addgene_67899 Copy
Species: Mus musculus
Genetic Insert: nesprin-2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcdna 3.1 -; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26745407
Proper citation: RRID:Addgene_68128 Copy
Species: Mus musculus
Genetic Insert: mouse nesprin mini 2G
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcdna 3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26745407
Proper citation: RRID:Addgene_68127 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21122816
Proper citation: RRID:Addgene_68029 Copy
Species: Mus musculus
Genetic Insert: Semaphorin-4F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21122816
Proper citation: RRID:Addgene_68033 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
