Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSAM2_mCherry_Gata6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_72694 | Gata 6 | Mus musculus | Ampicillin | PMID:26877223 | Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 2 | ||
|
pSAM2_mCherry_Mesp2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_72693 | Mesp 2 | Mus musculus | Ampicillin | PMID:26877223 | Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 1 | ||
|
pRK5-H1-shRNA-CMV-HA-PACSIN1 Resource Report Resource Website |
RRID:Addgene_72577 | PACSIN1 | Mus musculus | Ampicillin | PMID:23918399 | Backbone Size:5000; Vector Backbone:pRK5; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 5 silent mutations around shRNA recognition sequence | 2026-08-29 01:09:53 | 0 | |
|
pSuper-PACSIN1-shRNA Resource Report Resource Website |
RRID:Addgene_72576 | PACSIN1 | Mus musculus | Ampicillin | PMID:23918399 | Backbone Marker:Oligoengine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:53 | 0 | ||
|
pGL4.10 Dub3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_72684 | Dub3 promoter | Mus musculus | Ampicillin | PMID:24695638 | Addgene NGS found a small number of single nucleotide discrepancies relative to Sanger sequencing results provided by the depositing laboratory. These do not affect plasmid function | Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10[luc]; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 4 | |
|
pcDNA3-Dub3 mouse Resource Report Resource Website |
RRID:Addgene_72682 | Dub3 | Mus musculus | Ampicillin | PMID:24207026 | Addgene Sanger sequencing detected an S4A mutation within the Dub3 translation that should not affect protein function | Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 0 | |
|
pSAM2_mCherry_Tbx5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_72688 | Tbx 5 | Mus musculus | Ampicillin | PMID:26877223 | Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 1 | ||
|
pSAM2_mCherry_Nkx2.5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_72689 | Nkx 2.5 | Mus musculus | Ampicillin | PMID:26877223 | Backbone Size:11391; Vector Backbone:pSAM2_GW_mCherry; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:55 | 1 | ||
|
pcDNA3.1-Flag-ZFP809(1-353) Resource Report Resource Website 1+ mentions |
RRID:Addgene_67788 | ZFP809 | Mus musculus | Ampicillin | PMID:19270682 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:11 | 2 | ||
|
pGEX-2TK-GST-mEKLF Resource Report Resource Website |
RRID:Addgene_67836 | EKLF | Mus musculus | Ampicillin | PMID:9707565 | Mutations G299S, and T305S have no functional consequences. | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4969; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Full-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S | 2026-08-29 01:09:12 | 0 |
|
pSG5-FLAG-mEKLF Zinc Fingers Resource Report Resource Website |
RRID:Addgene_67837 | EKLF | Mus musculus | Ampicillin | PMID:11287616 | Mutations G299S, T305S have no functional consequences. | Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Zinc Fingers are amino acids 287-end; this numbering is based on amino acid 19 as the initiator Methionine; See depositor comments below on mutations G299S, T305S | 2026-08-29 01:09:12 | 0 |
|
pSG5-FLAG-mEKLF Resource Report Resource Website |
RRID:Addgene_67833 | EKLF | Mus musculus | Ampicillin | PMID:25197097 | Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences. | Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Full-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S | 2026-08-29 01:09:12 | 0 |
|
pAAV-hsyn-flex-dsRed-shvgat Resource Report Resource Website 1+ mentions |
RRID:Addgene_67845 | AAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA | Mus musculus | Ampicillin | PMID:26094607 | this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid. transgene expression is Cre-dependent; contains flex switch All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands. The insert was read using primers in the dsred sequence: dsred 410: CGTAATGCAGAAGAAGACTATG dsred 530R: CCATGTAGATGGACTTGAACTC | Backbone Size:2700; Vector Backbone:pUC; Vector Types:Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:12 | 2 | |
|
EGFP-Caveolin3DGV Resource Report Resource Website |
RRID:Addgene_67886 | Cav3 | Mus musculus | Kanamycin | PMID:10385524 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Deletion of the first 53 amino acids of Caveolin3 | 2026-08-29 01:09:12 | 0 | |
|
GFP-mouse vinculin full length (889) Resource Report Resource Website 1+ mentions |
RRID:Addgene_67935 | Vinculin | Mus musculus | Kanamycin | PMID:25065757 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | L159P in vinculin | 2026-08-29 01:09:12 | 4 | |
|
pYC3.60-C1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_67899 | YC3.60 | Mus musculus | Kanamycin | PMID:26435194 | Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:12 | 2 | ||
|
pcdna nesprin HL Resource Report Resource Website 1+ mentions |
RRID:Addgene_68128 | nesprin-2 | Mus musculus | Ampicillin | PMID:26745407 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcdna 3.1 -; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted actin-binding domain | 2026-08-29 01:09:13 | 6 | |
|
pcdna nesprin TS Resource Report Resource Website 10+ mentions |
RRID:Addgene_68127 | mouse nesprin mini 2G | Mus musculus | Ampicillin | PMID:26745407 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcdna 3.1 +; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:09:13 | 10 | ||
|
pCRII-Sema4a-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68029 | Semaphorin-4A | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | a 2kb cDNA fragment for ISH probe synthesis | 2026-08-29 01:09:13 | 0 | |
|
pCRII-Sema4f-ISH-2kb Resource Report Resource Website |
RRID:Addgene_68033 | Semaphorin-4F | Mus musculus | Ampicillin and Kanamycin | PMID:21122816 | Backbone Marker:Invitrogen; Backbone Size:3973; Vector Backbone:pCRII-TOPO; Vector Types:mRNA In situ hybridization probe; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-29 01:09:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
