Plasmids   Select Another Resource Report Type

http://www.addgene.org/53082

Species: Thermus thermophilus
Genetic Insert: TtAgo
Vector Backbone Description: Backbone Marker:EMD Millipore; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24531762

Proper citation: RRID:Addgene_53082 Copy   

•   Source: Addgene

http://www.addgene.org/53126

Species: Homo sapiens
Genetic Insert: Gfa2
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8120611
Comments: The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation. Restriction sites that may be useful are as follows: EcoRI: flanks the gfa2, lacZ, and mP-1 segments Bgl II: 5' flank of gfa2 & 3' flank of mP-1 Bam HI: flanks the lacZ gene Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene Sph I and Hind III: cut uniquely just 3' of the mP-1 segment Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004).

Proper citation: RRID:Addgene_53126 Copy   

•   Source: Addgene

http://www.addgene.org/53087

Species: Arabidopsis thaliana
Genetic Insert: zep
Vector Backbone Description: Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:10040; Vector Backbone:pAC-ZEAXipi; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24506237
Comments: For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter.

Proper citation: RRID:Addgene_53087 Copy   

•   Source: Addgene

http://www.addgene.org/53093

Species: Aphelenchus avenae
Genetic Insert: AavLEA1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25120007

Proper citation: RRID:Addgene_53093 Copy   

•   Source: Addgene

http://www.addgene.org/53015

Species: E. coli
Genetic Insert: fimE
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_53015 Copy   

•   Source: Addgene

http://www.addgene.org/53137

Species: Mus musculus
Genetic Insert: Ubc9
Vector Backbone Description: Backbone Size:3666; Vector Backbone:pET23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11792325

Proper citation: RRID:Addgene_53137 Copy   

•   Source: Addgene

http://www.addgene.org/53013

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22618873

Proper citation: RRID:Addgene_53013 Copy   

•   Source: Addgene

http://www.addgene.org/53014

Species: E.coli
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_53014 Copy   

•   Source: Addgene

http://www.addgene.org/53011

Species: E.coli
Genetic Insert: DsrA sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298

Proper citation: RRID:Addgene_53011 Copy   

•   Source: Addgene

http://www.addgene.org/53132

Species: Homo sapiens
Genetic Insert: Gfa2
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16496373
Comments: This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126) constructed by inserting 3 copies of the gfa2 B segment (Besnard et al. 1991) into the Sma I site just upstream of the basal promoter. It has about 75 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.

Proper citation: RRID:Addgene_53132 Copy   

•   Source: Addgene

http://www.addgene.org/53017

Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_53017 Copy   

•   Source: Addgene

http://www.addgene.org/53018

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_53018 Copy   

•   Source: Addgene

http://www.addgene.org/53026

Species: E.coli
Genetic Insert: csrA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23878244

Proper citation: RRID:Addgene_53026 Copy   

•   Source: Addgene

http://www.addgene.org/53024

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_53024 Copy   

•   Source: Addgene

http://www.addgene.org/53022

Species: E.coli
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_53022 Copy   

•   Source: Addgene

http://www.addgene.org/53023

Species: E.coli
Genetic Insert: fimB
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_53023 Copy   

•   Source: Addgene

http://www.addgene.org/53020

Species: E.coli
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25087841
Comments: The AAV-tag was added to gfp by PCR.

Proper citation: RRID:Addgene_53020 Copy   

•   Source: Addgene

http://www.addgene.org/46123

Species: Synthetic
Genetic Insert: LexA-QF
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46123 Copy   

•   Source: Addgene

http://www.addgene.org/46128

Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46128 Copy   

•   Source: Addgene

http://www.addgene.org/46085

Genetic Insert: DR-GFPuniv reporter
Vector Backbone Description: Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22121229
Comments: Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern.

Proper citation: RRID:Addgene_46085 Copy   

•   Source: Addgene