Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pWUR703 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53082 | TtAgo | Thermus thermophilus | Spectinomycin | PMID:24531762 | Backbone Marker:EMD Millipore; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | D478A D546A | 2026-08-15 01:16:27 | 1 | |
|
pGfa2-nLac Resource Report Resource Website 1+ mentions |
RRID:Addgene_53126 | Gfa2 | Homo sapiens | Ampicillin | PMID:8120611 | The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation. Restriction sites that may be useful are as follows: EcoRI: flanks the gfa2, lacZ, and mP-1 segments Bgl II: 5' flank of gfa2 & 3' flank of mP-1 Bam HI: flanks the lacZ gene Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene Sph I and Hind III: cut uniquely just 3' of the mP-1 segment Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004). | Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin | contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG | 2026-08-15 01:16:28 | 5 |
|
pAC-VIOL Resource Report Resource Website |
RRID:Addgene_53087 | zep | Arabidopsis thaliana | Chloramphenicol | PMID:24506237 | For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter. | Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:10040; Vector Backbone:pAC-ZEAXipi; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol | Lacks codons for the first 60 N-terminal amino acids that are thought to comprise the chloroplast transit sequence | 2026-08-15 01:16:32 | 0 |
|
pET15b-AavLEA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53093 | AavLEA1 | Aphelenchus avenae | Ampicillin | PMID:25120007 | Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 4 | ||
|
pHL 636 Resource Report Resource Website |
RRID:Addgene_53015 | fimE | E. coli | Ampicillin | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | |||
|
pET23a-mUbc9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53137 | Ubc9 | Mus musculus | Ampicillin | PMID:11792325 | Backbone Size:3666; Vector Backbone:pET23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | protein sequence is identical to human | 2026-08-15 01:16:28 | 2 | |
|
pHL 1023 Resource Report Resource Website |
RRID:Addgene_53013 | mCherry | Synthetic | Ampicillin | PMID:22618873 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pHL 246 Resource Report Resource Website |
RRID:Addgene_53014 | GFP | E.coli | Chloramphenicol and Ampicillin | PMID:25087841 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pHL 1410 Resource Report Resource Website |
RRID:Addgene_53011 | DsrA sRNA | E.coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pGfa(B3)-nLac Resource Report Resource Website |
RRID:Addgene_53132 | Gfa2 | Homo sapiens | Ampicillin | PMID:16496373 | This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126) constructed by inserting 3 copies of the gfa2 B segment (Besnard et al. 1991) into the Sma I site just upstream of the basal promoter. It has about 75 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic. | Vector Backbone:pUC18; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin | -2163 to +47, with 3 copies of the gfa2 B segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG | 2026-08-15 01:16:28 | 0 |
|
pHL 1277 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53017 | GFP | Aequorea victoria | Ampicillin | PMID:25087841 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 1 | ||
|
pHL 1278 Resource Report Resource Website |
RRID:Addgene_53018 | mCherry | Synthetic | Ampicillin | PMID:25087841 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pHL1506 Resource Report Resource Website |
RRID:Addgene_53026 | csrA | E.coli | Kanamycin | PMID:23878244 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:27 | 0 | ||
|
pHL 1917 Resource Report Resource Website |
RRID:Addgene_53024 | mCherry | Synthetic | Ampicillin | PMID:25087841 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pHL 1915 Resource Report Resource Website |
RRID:Addgene_53022 | GFP | E.coli | Chloramphenicol and Ampicillin | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:16:27 | 0 | |||
|
pHL 1916 Resource Report Resource Website |
RRID:Addgene_53023 | fimB | E.coli | Ampicillin | PMID:25087841 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pHL 1903 Resource Report Resource Website |
RRID:Addgene_53020 | GFP | E.coli | Chloramphenicol and Ampicillin | PMID:25087841 | The AAV-tag was added to gfp by PCR. | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:16:27 | 0 | |
|
pattB-synaptobrevin-14-LEXA-QF-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46123 | LexA-QF | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 1 | |
|
pCaSpeR4-tubulin-QF#7m1 Resource Report Resource Website |
RRID:Addgene_46128 | QF#7m1 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7743; Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:29 | 0 | |
|
pDR-GFPuniv Resource Report Resource Website 1+ mentions |
RRID:Addgene_46085 | DR-GFPuniv reporter | Ampicillin | PMID:22121229 | Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633. Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the 3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site). Sample oligonucleotide pair: oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’ oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’ Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern. | Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin | E5G and K163R mutations in EGFP relative to wild-type. EGFP truncated after amino acid 163 | 2026-08-15 01:15:29 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
