Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:9100; Vector Backbone:pDRf1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17293878
Proper citation: RRID:Addgene_36026 Copy
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407306
Proper citation: RRID:Addgene_36029 Copy
Species: Homo sapiens
Genetic Insert: WASp
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:6857; Vector Backbone:pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431569
Proper citation: RRID:Addgene_36250 Copy
Species: Homo sapiens
Genetic Insert: cyclophilin B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22426501
Proper citation: RRID:Addgene_36134 Copy
Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Brachyury palindromic element:
AATTTCACACCTAGGTGTGAAATT
Proper citation: RRID:Addgene_36246 Copy
Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Mutated Brachyury palindromic element:
AATTTGGGACCTAGGTCCCAAATT
Proper citation: RRID:Addgene_36245 Copy
Genetic Insert: yEHA
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4872; Vector Backbone:pBS35; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Proper citation: RRID:Addgene_36242 Copy
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:pCY 3120-01; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Comments: The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.
Proper citation: RRID:Addgene_36238 Copy
Genetic Insert: URA3
Vector Backbone Description: Vector Backbone:pCY 3090-02; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Comments: The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.
Proper citation: RRID:Addgene_36233 Copy
Genetic Insert: yECitrine
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4882; Vector Backbone:pBS7; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Proper citation: RRID:Addgene_36225 Copy
Genetic Insert: yEVenus
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4882; Vector Backbone:pBS7; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Proper citation: RRID:Addgene_36224 Copy
Species: Streptoalloteichus hindustanus
Genetic Insert: Streptoalloteichus hindustanus bleomycin (Sh ble)
Vector Backbone Description: Vector Backbone:pCY 3080-01; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Comments: The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.
Proper citation: RRID:Addgene_36227 Copy
Genetic Insert: Homodimeric FokI Nuclease
Vector Backbone Description: Vector Backbone:pCP4; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124327
Comments: Note that there are some minor discrepancies between the Addgene quality control sequence and the sequence from the depositor. These differences will not affect the function of the plasmid.
Proper citation: RRID:Addgene_36187 Copy
Genetic Insert: FokI homodimeric Nuclease domain
Vector Backbone Description: Vector Backbone:pCP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124327
Proper citation: RRID:Addgene_36186 Copy
Genetic Insert: yEGFP
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4882; Vector Backbone:pBS7; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Proper citation: RRID:Addgene_36217 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast-enhanced (yE) polylinker
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4875; Vector Backbone:pBS10; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Proper citation: RRID:Addgene_36210 Copy
Species: Homo sapiens
Genetic Insert: Sec23A
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLVX-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21045114
Comments: The cDNA sequence encoding mRuby (Kredel et al., 2009) underwent codon usage
adaptation before gene synthesis (MWG Eurofins) and cloning into pBluescript II
SK(+). mRuby was excised with SalI-EcoRI for insertion into pLVX-Puro (Clontech)
to generate pLVX-Puro–mRuby. A cDNA encoding human Sec23A was amplified
by PCR, gel purified and subcloned via pGEM-T vector (excised with ApaI-XbaI)
and cloned into pLVX-Puro–mRuby.
Proper citation: RRID:Addgene_36158 Copy
Species: Rattus norvegicus
Genetic Insert: CD200R
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6000; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Proper citation: RRID:Addgene_36153 Copy
Species: Plasmodium falciparum
Genetic Insert: ama1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6000; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22080952
Proper citation: RRID:Addgene_36146 Copy
Species: Mus musculus
Genetic Insert: Dynamin 3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17463283
Proper citation: RRID:Addgene_36265 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
