Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 390 showing 7781 ~ 7800 out of 328,858 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/161597

Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33893795

Proper citation: RRID:Addgene_161597 Copy   


  • RRID:Addgene_68495

    This resource has 1+ mentions.

http://www.addgene.org/68495

Species: Synthetic
Genetic Insert: dSaCas9
Vector Backbone Description: Vector Backbone:pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044

Proper citation: RRID:Addgene_68495 Copy   


http://www.addgene.org/187065

Species: Synthetic
Genetic Insert: miniABEmax-Gp41-1
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489

Proper citation: RRID:Addgene_187065 Copy   


http://www.addgene.org/187064

Species: Synthetic
Genetic Insert: miniABEmax-Npu
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489

Proper citation: RRID:Addgene_187064 Copy   


http://www.addgene.org/187063

Species: Synthetic
Genetic Insert: Npu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutation
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489

Proper citation: RRID:Addgene_187063 Copy   


  • RRID:Addgene_186938

http://www.addgene.org/186938

Species: Mus musculus
Genetic Insert: Hira KO sgRNA
Vector Backbone Description: Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523900

Proper citation: RRID:Addgene_186938 Copy   


  • RRID:Addgene_149447

    This resource has 1+ mentions.

http://www.addgene.org/149447

Genetic Insert: P2A-BFP
Vector Backbone Description: Backbone Size:12364; Vector Backbone:pLenti-Cas9; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33977487

Proper citation: RRID:Addgene_149447 Copy   


  • RRID:Addgene_186685

http://www.addgene.org/186685

Species: Rattus norvegicus
Genetic Insert: Syntaxin 3
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233

Proper citation: RRID:Addgene_186685 Copy   


  • RRID:Addgene_187021

http://www.addgene.org/187021

Species: Mus musculus
Genetic Insert: KASH2
Vector Backbone Description: Vector Backbone:pPB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Inducible construct via doxycycline addition

Proper citation: RRID:Addgene_187021 Copy   


  • RRID:Addgene_187020

http://www.addgene.org/187020

Species: Mus musculus
Genetic Insert: KASH2ext
Vector Backbone Description: Vector Backbone:pPB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Inducible construct via doxycycline addition

Proper citation: RRID:Addgene_187020 Copy   


http://www.addgene.org/186307

Species: Synthetic
Genetic Insert: P9-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250

Proper citation: RRID:Addgene_186307 Copy   


http://www.addgene.org/186305

Species: Synthetic
Genetic Insert: P3-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250

Proper citation: RRID:Addgene_186305 Copy   


http://www.addgene.org/186668

Species: Homo sapiens
Genetic Insert: ANKRD1 KO Hygromycin
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186668 Copy   


http://www.addgene.org/186314

Species: Synthetic
Genetic Insert: Z18-ehaA
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250

Proper citation: RRID:Addgene_186314 Copy   


http://www.addgene.org/186311

Species: Synthetic
Genetic Insert: sg83-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250

Proper citation: RRID:Addgene_186311 Copy   


  • RRID:Addgene_185108

http://www.addgene.org/185108

Species: Saccharomyces cerevisiae
Genetic Insert: POM152
Vector Backbone Description: Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34557894

Proper citation: RRID:Addgene_185108 Copy   


http://www.addgene.org/186315

Species: Synthetic
Genetic Insert: P3-ehaA
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250

Proper citation: RRID:Addgene_186315 Copy   


http://www.addgene.org/187181

Species: Synthetic
Genetic Insert: PE2 from plasmid #132775
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35294257

Proper citation: RRID:Addgene_187181 Copy   


  • RRID:Addgene_186655

http://www.addgene.org/186655

Species: Drosophila melanogaster
Genetic Insert: OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186655 Copy   


  • RRID:Addgene_186653

http://www.addgene.org/186653

Species: Drosophila melanogaster
Genetic Insert: Piwi sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_186653 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X