Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33893795
Proper citation: RRID:Addgene_161597 Copy
Species: Synthetic
Genetic Insert: dSaCas9
Vector Backbone Description: Vector Backbone:pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044
Proper citation: RRID:Addgene_68495 Copy
Species: Synthetic
Genetic Insert: miniABEmax-Gp41-1
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489
Proper citation: RRID:Addgene_187065 Copy
Species: Synthetic
Genetic Insert: miniABEmax-Npu
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489
Proper citation: RRID:Addgene_187064 Copy
Species: Synthetic
Genetic Insert: Npu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutation
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34140489
Proper citation: RRID:Addgene_187063 Copy
Species: Mus musculus
Genetic Insert: Hira KO sgRNA
Vector Backbone Description: Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35523900
Proper citation: RRID:Addgene_186938 Copy
Genetic Insert: P2A-BFP
Vector Backbone Description: Backbone Size:12364; Vector Backbone:pLenti-Cas9; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33977487
Proper citation: RRID:Addgene_149447 Copy
Species: Rattus norvegicus
Genetic Insert: Syntaxin 3
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233
Proper citation: RRID:Addgene_186685 Copy
Species: Mus musculus
Genetic Insert: KASH2
Vector Backbone Description: Vector Backbone:pPB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Inducible construct via doxycycline addition
Proper citation: RRID:Addgene_187021 Copy
Species: Mus musculus
Genetic Insert: KASH2ext
Vector Backbone Description: Vector Backbone:pPB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Inducible construct via doxycycline addition
Proper citation: RRID:Addgene_187020 Copy
Species: Synthetic
Genetic Insert: P9-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250
Proper citation: RRID:Addgene_186307 Copy
Species: Synthetic
Genetic Insert: P3-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250
Proper citation: RRID:Addgene_186305 Copy
Species: Homo sapiens
Genetic Insert: ANKRD1 KO Hygromycin
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186668 Copy
Species: Synthetic
Genetic Insert: Z18-ehaA
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250
Proper citation: RRID:Addgene_186314 Copy
Species: Synthetic
Genetic Insert: sg83-PDGFR
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250
Proper citation: RRID:Addgene_186311 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: POM152
Vector Backbone Description: Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34557894
Proper citation: RRID:Addgene_185108 Copy
Species: Synthetic
Genetic Insert: P3-ehaA
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36055250
Proper citation: RRID:Addgene_186315 Copy
Species: Synthetic
Genetic Insert: PE2 from plasmid #132775
Vector Backbone Description: Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35294257
Proper citation: RRID:Addgene_187181 Copy
Species: Drosophila melanogaster
Genetic Insert: OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186655 Copy
Species: Drosophila melanogaster
Genetic Insert: Piwi sgRNA Plasmid
Vector Backbone Description: Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35639929
Comments: sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_186653 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
