Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 391 showing 7801 ~ 7820 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_21403

    This resource has 1+ mentions.

http://www.addgene.org/21403

Species: Homo sapiens
Genetic Insert: HIF1AN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12615973

Proper citation: RRID:Addgene_21403 Copy   


  • RRID:Addgene_21368

    This resource has 1+ mentions.

http://www.addgene.org/21368

Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown.

Proper citation: RRID:Addgene_21368 Copy   


  • RRID:Addgene_21367

    This resource has 1+ mentions.

http://www.addgene.org/21367

Species: Homo sapiens
Genetic Insert: autosomal dominant polycystic kidney disease type I
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482949
Comments: *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243).

Proper citation: RRID:Addgene_21367 Copy   


  • RRID:Addgene_21338

    This resource has 1+ mentions.

http://www.addgene.org/21338

Species: Mus musculus
Genetic Insert: DEPTOR shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 2 TRCN0000110159; NM_145470.1-1165s1c1 shRNA oligo sequence is - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG

Proper citation: RRID:Addgene_21338 Copy   


  • RRID:Addgene_21337

    This resource has 1+ mentions.

http://www.addgene.org/21337

Species: Mus musculus
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse DEPTOR shRNA 1 TRCN0000110157; NM_145470.1-1164s1c1 shRNA oligo sequence is - 5'-CCGGCGCAAGGAAGACATTCACGATCTCGAGATCG TGAATGTCTTCCTTGCGTTTTTG

Proper citation: RRID:Addgene_21337 Copy   


  • RRID:Addgene_21299

    This resource has 1+ mentions.

http://www.addgene.org/21299

Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pLew100; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19369939
Comments: There are a few discrepancies between Addgene's sequence and the provided sequence from the depositing lab. These discrepancies do not affect plasmid function.

Proper citation: RRID:Addgene_21299 Copy   


  • RRID:Addgene_21298

    This resource has 1+ mentions.

http://www.addgene.org/21298

Species: Homo sapiens
Genetic Insert: shMTH1-2
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′.

Proper citation: RRID:Addgene_21298 Copy   


  • RRID:Addgene_21297

    This resource has 1+ mentions.

http://www.addgene.org/21297

Species: Homo sapiens
Genetic Insert: shMTH1-1
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′.

Proper citation: RRID:Addgene_21297 Copy   


  • RRID:Addgene_21335

    This resource has 1+ mentions.

http://www.addgene.org/21335

Species: Homo sapiens
Genetic Insert: DEPTOR shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG

Proper citation: RRID:Addgene_21335 Copy   


  • RRID:Addgene_21295

    This resource has 1+ mentions.

http://www.addgene.org/21295

Species: Homo sapiens
Genetic Insert: MTH1
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19118192
Comments: The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector.

Proper citation: RRID:Addgene_21295 Copy   


  • RRID:Addgene_21341

    This resource has 1+ mentions.

http://www.addgene.org/21341

Species: Mus musculus
Genetic Insert: rictor shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19150980
Comments: mouse rictor shRNA 1 shRNA oligo sequence is 5'- CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG -3'

Proper citation: RRID:Addgene_21341 Copy   


  • RRID:Addgene_21340

    This resource has 1+ mentions.

http://www.addgene.org/21340

Species: Mus musculus
Genetic Insert: raptor shRNA 2
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19446321
Comments: mouse raptor shRNA 2 shRNA oligo sequence is 5'- CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG -3'

Proper citation: RRID:Addgene_21340 Copy   


  • RRID:Addgene_21606

    This resource has 1+ mentions.

http://www.addgene.org/21606

Species: Homo sapiens
Genetic Insert: MCL-1 S159A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1 /V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16543145

Proper citation: RRID:Addgene_21606 Copy   


  • RRID:Addgene_21563

    This resource has 1+ mentions.

http://www.addgene.org/21563

Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase kinase 4
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7997269
Comments: missing first 10 amino acids

Proper citation: RRID:Addgene_21563 Copy   


  • RRID:Addgene_21562

    This resource has 1+ mentions.

http://www.addgene.org/21562

Genetic Insert: No insert
Vector Backbone Description: Backbone Size:6909; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Bleocin (Zeocin)
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_21562 Copy   


  • RRID:Addgene_21536

    This resource has 1+ mentions.

http://www.addgene.org/21536

Species: Homo sapiens
Genetic Insert: Ago4
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19324964

Proper citation: RRID:Addgene_21536 Copy   


  • RRID:Addgene_21535

    This resource has 1+ mentions.

http://www.addgene.org/21535

Species: Homo sapiens
Genetic Insert: Ago1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCl-neo_NHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19324964

Proper citation: RRID:Addgene_21535 Copy   


http://www.addgene.org/21496

Species: Homo sapiens
Genetic Insert: 1.5kb 5' of miR-145
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pTransluc (Panomics); Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19409607
Comments: Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.

Proper citation: RRID:Addgene_21496 Copy   


  • RRID:Addgene_21495

    This resource has 1+ mentions.

http://www.addgene.org/21495

Species: Saccharomyces cerevisiae
Genetic Insert: VPS4
Vector Backbone Description: Backbone Size:5037; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443

Proper citation: RRID:Addgene_21495 Copy   


  • RRID:Addgene_21492

    This resource has 1+ mentions.

http://www.addgene.org/21492

Species: Saccharomyces cerevisiae
Genetic Insert: SNF7
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443

Proper citation: RRID:Addgene_21492 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X