Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pJZC25 Resource Report Resource Website |
RRID:Addgene_62328 | sgRNA + 1x MS2 binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-29 01:08:23 | 0 | ||
|
pJZC35 Resource Report Resource Website |
RRID:Addgene_62325 | sgRNA | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:23 | 0 | |||
|
pJZC77 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62338 | sgRNA | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets sv40 promoter, sequence: CATACTTCTGCCTGCTGGGGAGCCTG | 2026-08-29 01:08:26 | 1 | ||
|
pJZC40 Resource Report Resource Website |
RRID:Addgene_62334 | sgRNA + 2x PP7 | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-29 01:08:23 | 0 | ||
|
pJZC48 Resource Report Resource Website |
RRID:Addgene_62336 | sgRNA + 1x COM binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-29 01:08:23 | 0 | ||
|
pJZC33 Resource Report Resource Website |
RRID:Addgene_62330 | sgRNA + 2x MS2 binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-29 01:08:23 | 0 | ||
|
pBSKΔB-CAG-MCP-tdiRFP670-IRES-Neo Resource Report Resource Website |
RRID:Addgene_62345 | MCP-tdiRFP670 | Synthetic | Ampicillin | PMID:26092696 | Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:23 | 0 | ||
|
pBSKΔB- CAG-rtTA2sM2-IRES-tTSkid-IRES-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_62346 | rtTA2sM2-IRES-tTSkid | Synthetic | Ampicillin | PMID:26092696 | Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:23 | 1 | ||
|
pJZC74 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62342 | sgRNA + 1x COM binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets sv40 promoter, sequence: GAATAGCTCAGAGGCCGAGG | 2026-08-29 01:08:23 | 1 | ||
|
pJZC116 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62344 | sgRNA + 2x MS2 (wt+f6) binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGC | 2026-08-29 01:08:26 | 1 | ||
|
pJW1504 Resource Report Resource Website |
RRID:Addgene_62358 | RPS2 fragment | Saccharomyces cerevisiae | Ampicillin | PMID:25378630 | Backbone Size:4373; Vector Backbone:pRS306; Vector Types:yeast targeting; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:23 | 0 | ||
|
pJW1505 Resource Report Resource Website |
RRID:Addgene_62359 | RPL16A | Saccharomyces cerevisiae | Ampicillin | PMID:25378630 | Vector Backbone:pRS306; Vector Types:yeast tagging; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:26 | 0 | ||
|
pTV-Oct4-TK-HMS Resource Report Resource Website |
RRID:Addgene_62351 | TK-Hyg-24xMS2 | Mus musculus | Ampicillin | PMID:26092696 | Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:23 | 0 | ||
|
MXS_mAzamiGreen Resource Report Resource Website |
RRID:Addgene_62404 | mAzamiGreen | Synthetic | Ampicillin | PMID:25909630 | Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:24 | 0 | ||
|
MXS_Cerulean Resource Report Resource Website |
RRID:Addgene_62401 | Cerulean | Synthetic | Ampicillin | PMID:25909630 | Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:24 | 0 | ||
|
pJW1511 Resource Report Resource Website |
RRID:Addgene_62365 | Puro-T2A-AVITEVHAmmuRPL10A | Mus musculus | Ampicillin | PMID:25378630 | Vector Backbone:pMK1047; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:26 | 0 | ||
|
pJW1506 Resource Report Resource Website |
RRID:Addgene_62360 | RPL16B | Saccharomyces cerevisiae | Ampicillin | PMID:25378630 | Vector Backbone:pRS306; Vector Types:yeast targeting; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:24 | 0 | ||
|
FRE5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62377 | dsRed and GFP | Other | Ampicillin | PMID:17142220 | The plasmid contains commercially generated dsRED and EGFP fluorescent proteins | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:26 | 2 | |
|
pcDNA-gp78-FLAG Resource Report Resource Website |
RRID:Addgene_62370 | gp78 | Homo sapiens | Ampicillin | PMID:24424410 | *P179L mutation found during Addgene's quality control sequencing is not known to affect function | Backbone Size:5400; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | * | 2026-08-29 01:08:24 | 0 |
|
MXS_SV40pA Resource Report Resource Website |
RRID:Addgene_62426 | SV40 poly A | Synthetic | Ampicillin | PMID:25909630 | Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:24 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.