Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21135224
Proper citation: RRID:Addgene_27136 Copy
Species: Homo sapiens
Genetic Insert: CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21135224
Proper citation: RRID:Addgene_27134 Copy
Species: Homo sapiens
Genetic Insert: CK2alpha
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4952; Vector Backbone:pGEX-3X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21036246
Proper citation: RRID:Addgene_27083 Copy
Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCS2; Vector Types:xenopus/mammalian/avian/zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: A204 was mutated back to the WT residue on the original pCS2-Flag Smad3 EPSM plasmid.
Proper citation: RRID:Addgene_27111 Copy
Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: A213 was mutated back to the wild type residue in EPSM construct
Proper citation: RRID:Addgene_27110 Copy
Species: Homo sapiens
Genetic Insert: CK2beta
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21036246
Proper citation: RRID:Addgene_27085 Copy
Species: Homo sapiens
Genetic Insert: MKL2
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:0; Vector Backbone:p3XFLAG-CMV7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14565952
Proper citation: RRID:Addgene_27175 Copy
Species: Homo sapiens
Genetic Insert: ATF6
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10856300
Comments: This is the activated (nuclear) form of ATF6.
Please note that mutation M13I in ATF6 was found during Addgene's quality control. The plasmid should function as described in the associated publication above.
Proper citation: RRID:Addgene_27173 Copy
Species: Homo sapiens
Genetic Insert: αTubulin K40 acetyltransferase
Vector Backbone Description: Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21068373
Proper citation: RRID:Addgene_27101 Copy
Species: Homo sapiens
Genetic Insert: ELK1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20466732
Proper citation: RRID:Addgene_27156 Copy
Species: Homo sapiens
Genetic Insert: Septin 5
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18385322
Proper citation: RRID:Addgene_27269 Copy
Species: Homo sapiens
Genetic Insert: REL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17072339
Comments: Please note that Addgene's sequencing results confirmed N424 is present in the REL sequence. Despite the plasmid name, amino acids 425-490 of REL have been deleted. This plasmid is exactly as created by the depositing laboratory and as described in the associated publication listed below and in Chin et al., Oncogene. 2009 May 21;28(20):2100-11.
Proper citation: RRID:Addgene_27267 Copy
Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27294 Copy
Species: Homo sapiens
Genetic Insert: protein kinase B beta
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Comments: There is a silent mutation at nt552 (CGG->CGA) of the depositor's seq. This mutation does not alter the amino acid sequence.
Proper citation: RRID:Addgene_27295 Copy
Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6P; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Proper citation: RRID:Addgene_27222 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27419 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27425 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27424 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27422 Copy
Species: Homo sapiens
Genetic Insert: unligated form of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was
GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27386 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
