Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20868367
Proper citation: RRID:Addgene_27420 Copy
Species: Homo sapiens
Genetic Insert: post- ligation product of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19965478
Comments: pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is
GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27385 Copy
Species: Homo sapiens
Genetic Insert: Gja1
Vector Backbone Description: Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20038810
Proper citation: RRID:Addgene_27383 Copy
Species: Homo sapiens
Genetic Insert: shYAP1
Vector Backbone Description: Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18579750
Comments: YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC
Proper citation: RRID:Addgene_27368 Copy
Species: Homo sapiens
Genetic Insert: BRCC36
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20656689
Proper citation: RRID:Addgene_27496 Copy
Species: Homo sapiens
Genetic Insert: P190
Vector Backbone Description: Backbone Marker:Hawley et al., 1994; Backbone Size:0; Vector Backbone:MSCV2.2 (MIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11929787
Proper citation: RRID:Addgene_27483 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27458 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Marker:Takara; Backbone Size:4407; Vector Backbone:pCold 1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27453 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27450 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18434538
Proper citation: RRID:Addgene_27467 Copy
Species: Homo sapiens
Genetic Insert: PSMD14
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20656689
Proper citation: RRID:Addgene_27500 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:0; Vector Backbone:pRS303 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18434538
Proper citation: RRID:Addgene_27468 Copy
Species: Homo sapiens
Genetic Insert: RAP80
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20656689
Comments: There are I41V and E175G mutations in RAP80 that should not affect plasmid function.
Proper citation: RRID:Addgene_27501 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:7099; Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18434538
Proper citation: RRID:Addgene_27466 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:0; Vector Backbone:GSTDuet (pGV313); Vector Types:Bacterial Expression, Coexpression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27463 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Backbone Size:0; Vector Backbone:GSTDuet (pGV313); Vector Types:Bacterial Expression, Coexpression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19465477
Proper citation: RRID:Addgene_27464 Copy
Species: Homo sapiens
Genetic Insert: Tpl2/Cot
Vector Backbone Description: Backbone Marker:Addgene Plasmid 12343 (Dr. Inder Verma); Backbone Size:7807; Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16565081
Proper citation: RRID:Addgene_27558 Copy
Species: Homo sapiens
Genetic Insert: CYLD
Vector Backbone Description: Backbone Marker:Addgene Plasmid 12343 (Dr. Inder Verma); Backbone Size:7807; Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15870263
Comments: Please note that this is the exact plasmid (including mutations) used in the associated publication listed below.
Proper citation: RRID:Addgene_27556 Copy
Species: Homo sapiens
Genetic Insert: Cdk2
Vector Backbone Description: Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11283255
Comments: See attachment for description of backbone.
Proper citation: RRID:Addgene_27651 Copy
Species: Homo sapiens
Genetic Insert: human ULK2 shRNA 91
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK2 shRNA 91 TRC candidate.
shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3'
Proper citation: RRID:Addgene_27634 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
