Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBABEpuro-Flag-ZO-2 Resource Report Resource Website |
RRID:Addgene_27420 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 0 | ||
|
pH307HP Resource Report Resource Website |
RRID:Addgene_27385 | post- ligation product of ligase ribozyme | Homo sapiens | Ampicillin | PMID:19965478 | pH307HP is used to transcribe RNA representing the post- ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG GACCCAC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease. | Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 0 | |
|
plenti6.3/hCx43-stop Resource Report Resource Website 1+ mentions |
RRID:Addgene_27383 | Gja1 | Homo sapiens | Ampicillin | PMID:20038810 | Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 2 | ||
|
pLKO1-shYAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_27368 | shYAP1 | Homo sapiens | Ampicillin | PMID:18579750 | YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC | Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:02 | 20 | |
|
pOZ-N-FH BRCC36 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27496 | BRCC36 | Homo sapiens | Ampicillin | PMID:20656689 | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 2 | ||
|
Mig P190 (Mig 185) Resource Report Resource Website |
RRID:Addgene_27483 | P190 | Homo sapiens | Ampicillin | PMID:11929787 | Backbone Marker:Hawley et al., 1994; Backbone Size:0; Vector Backbone:MSCV2.2 (MIG); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Contains only exon 1 (e1) of bcr fused to abl | 2026-08-15 01:13:04 | 0 | |
|
pRS416 Gal TDP43 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_27458 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 1 | ||
|
pCold TDP43 M337V Resource Report Resource Website |
RRID:Addgene_27453 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Marker:Takara; Backbone Size:4407; Vector Backbone:pCold 1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Methionine 337 mutated to Valine (M337V) | 2026-08-15 01:13:03 | 0 | |
|
pRS416 Gal Q331K YFP Resource Report Resource Website |
RRID:Addgene_27450 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Size:5000; Vector Backbone:pRS416GAL; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Glutamine 331 mutated to Lysine (Q331K) | 2026-08-15 01:13:03 | 0 | |
|
pRS426 Gal TDP43 GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27467 | TDP-43 | Homo sapiens | Ampicillin | PMID:18434538 | Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:03 | 2 | ||
|
pOZ-N-FH PSMD14 Resource Report Resource Website |
RRID:Addgene_27500 | PSMD14 | Homo sapiens | Ampicillin | PMID:20656689 | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | M1V | 2026-08-15 01:13:04 | 0 | |
|
pRS303 Gal TDP-43 YFP Resource Report Resource Website |
RRID:Addgene_27468 | TDP-43 | Homo sapiens | Ampicillin | PMID:18434538 | Backbone Size:0; Vector Backbone:pRS303 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | D23A mutation in TDP-43 sequence | 2026-08-15 01:13:03 | 0 | |
|
pOZ-N-FH RAP80 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27501 | RAP80 | Homo sapiens | Ampicillin | PMID:20656689 | There are I41V and E175G mutations in RAP80 that should not affect plasmid function. | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 1 | |
|
pRS426 Gal TDP43 Resource Report Resource Website |
RRID:Addgene_27466 | TDP-43 | Homo sapiens | Ampicillin | PMID:18434538 | Backbone Size:7099; Vector Backbone:pRS426 Gal; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 0 | ||
|
pDuet TDP-43 G294A Resource Report Resource Website |
RRID:Addgene_27463 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Size:0; Vector Backbone:GSTDuet (pGV313); Vector Types:Bacterial Expression, Coexpression; Bacterial Resistance:Ampicillin | Glycine 294 mutated to Alanine (G294A) | 2026-08-15 01:13:03 | 0 | |
|
pDuet TDP-43 M337V Resource Report Resource Website |
RRID:Addgene_27464 | TDP-43 | Homo sapiens | Ampicillin | PMID:19465477 | Backbone Size:0; Vector Backbone:GSTDuet (pGV313); Vector Types:Bacterial Expression, Coexpression; Bacterial Resistance:Ampicillin | Methionine 337 mutated to Valine (M337V) | 2026-08-15 01:13:03 | 0 | |
|
pCLXSN-Tpl2/Cot Resource Report Resource Website |
RRID:Addgene_27558 | Tpl2/Cot | Homo sapiens | Ampicillin | PMID:16565081 | Backbone Marker:Addgene Plasmid 12343 (Dr. Inder Verma); Backbone Size:7807; Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:05 | 0 | ||
|
pCLXSN-HA-CYLD Resource Report Resource Website |
RRID:Addgene_27556 | CYLD | Homo sapiens | Ampicillin | PMID:15870263 | Please note that this is the exact plasmid (including mutations) used in the associated publication listed below. | Backbone Marker:Addgene Plasmid 12343 (Dr. Inder Verma); Backbone Size:7807; Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | R156G and G179R | 2026-08-15 01:13:04 | 0 |
|
pUHD Cdk2 DN HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27651 | Cdk2 | Homo sapiens | Ampicillin | PMID:11283255 | See attachment for description of backbone. | Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D146N (Dominant Negative) | 2026-08-15 01:13:05 | 1 |
|
pLKO human ULK2 shRNA 91 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27634 | human ULK2 shRNA 91 | Homo sapiens | Ampicillin | PMID:21205641 | human ULK2 shRNA 91 TRC candidate. shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3' | Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:04 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
