Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: human ULK1 shRNA 8 TRC candidate.
shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'
Proper citation: RRID:Addgene_27633 Copy
Species: Homo sapiens
Genetic Insert: STIM1
Vector Backbone Description: Backbone Marker:See author's map; Backbone Size:6000; Vector Backbone:MO91; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16921383
Comments: See Author's Map for empty backbone (MO91) information.
Proper citation: RRID:Addgene_19754 Copy
Species: Homo sapiens
Genetic Insert: MKK7B2Jnk1a1(APF)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12052897
Proper citation: RRID:Addgene_19730 Copy
Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914
Proper citation: RRID:Addgene_19717 Copy
Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914
Proper citation: RRID:Addgene_19719 Copy
Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914
Proper citation: RRID:Addgene_19720 Copy
Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914
Proper citation: RRID:Addgene_19721 Copy
Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914
Proper citation: RRID:Addgene_19723 Copy
Species: Homo sapiens
Genetic Insert: MKK7B2Jnk1a1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12052897
Proper citation: RRID:Addgene_19726 Copy
Species: Homo sapiens
Genetic Insert: pCDNA3 FlagMKK7B2Jnk2a2
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12052897
Proper citation: RRID:Addgene_19727 Copy
Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Proper citation: RRID:Addgene_19758 Copy
Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Comments: 2279 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.
shRNA sequence for 2279 is:
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Proper citation: RRID:Addgene_19762 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Proper citation: RRID:Addgene_19763 Copy
Species: Homo sapiens
Genetic Insert: RHEBL1 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19858 Copy
Species: Homo sapiens
Genetic Insert: GSC 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19859 Copy
Species: Homo sapiens
Genetic Insert: SIRT4 3' UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19860 Copy
Species: Homo sapiens
Genetic Insert: IRF9 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19863 Copy
Species: Homo sapiens
Genetic Insert: hRpt6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7700; Vector Backbone:pQCXIP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19793 Copy
Species: Homo sapiens
Genetic Insert: NFRKB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19792 Copy
Species: Homo sapiens
Genetic Insert: CCDC95
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18922472
Proper citation: RRID:Addgene_19795 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
