Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Cry2 - mCherry - Profilin.S138E
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38457348
Comments: Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint.
Proper citation: RRID:Addgene_208287 Copy
Species: Mus musculus
Genetic Insert: msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
Vector Backbone Description: Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin
Comments: Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_215000 Copy
Species: Mus musculus
Genetic Insert: Cry2 - mCherry - Profilin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38457348
Comments: Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint.
Proper citation: RRID:Addgene_208288 Copy
Species: Mus musculus
Genetic Insert: U6-sgRNA-GFP
Vector Backbone Description: Backbone Size:3205; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38418885
Proper citation: RRID:Addgene_200068 Copy
Species: Mus musculus
Genetic Insert: GfaABC1D-jGCaMP8m
Vector Backbone Description: Backbone Marker:Khakh lab; Backbone Size:2821; Vector Backbone:PZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38418885
Comments: Insert subclone in PZAC2.1 vector from pGP-AAV-syn-jGCaMP8m-WPRE (#162375)
Proper citation: RRID:Addgene_213010 Copy
Species: Mus musculus
Genetic Insert: GfaABC1D-Crym-eGFP
Vector Backbone Description: Backbone Size:3307; Vector Backbone:PZac2.1; Vector Types:Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38418885
Proper citation: RRID:Addgene_200080 Copy
Species: Mus musculus
Genetic Insert: 3xRhotekin-GBD
Vector Backbone Description: Vector Backbone:delCMV-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38102112
Comments: the delCMV promotor was derived from Watanabe and Mitchison, 2002, Science, 295:1083
Proper citation: RRID:Addgene_214142 Copy
Species: Mus musculus
Genetic Insert: 2xHP1bCD-IFP2.0C
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38554702
Proper citation: RRID:Addgene_215750 Copy
Species: Mus musculus
Genetic Insert: Musashi-1
Vector Backbone Description: Backbone Size:5081; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_215704 Copy
Species: Mus musculus
Genetic Insert: Frizzled-4
Vector Backbone Description: Backbone Marker:Gibco; Vector Backbone:pFastBac1; Vector Types:Insect Expression, Baculovirus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35998232
Proper citation: RRID:Addgene_216378 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36069770
Proper citation: RRID:Addgene_206863 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36069770
Proper citation: RRID:Addgene_206862 Copy
Species: Mus musculus
Genetic Insert: Dishevelled-2
Vector Backbone Description: Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35998232
Proper citation: RRID:Addgene_216387 Copy
Species: Mus musculus
Genetic Insert: EEA1
Vector Backbone Description: Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214991 Copy
Species: Mus musculus
Genetic Insert: mouse liver DNase hypersensitive site # 29774
Vector Backbone Description: Vector Backbone:pGL4.10; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39716078
Comments: There is a 1bp deletion in all_tcpo_peak_29774 that is unlikely to affect function.
Proper citation: RRID:Addgene_220286 Copy
Species: Mus musculus
Genetic Insert: mouse liver DNase hypersensitive site # 50358
Vector Backbone Description: Vector Backbone:pGL4.10; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39716078
Proper citation: RRID:Addgene_220288 Copy
Species: Mus musculus
Genetic Insert: shErbb4
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223311 Copy
Species: Mus musculus
Genetic Insert: Nlgn1 - CTEV - PBM (TTRV)
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223306 Copy
Species: Mus musculus
Genetic Insert: Nlgn1 - CTEV
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223304 Copy
Species: Mus musculus
Genetic Insert: Lamp1
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39752501
Proper citation: RRID:Addgene_225136 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
