Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLKO human ULK1 shRNA 8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27633 | human ULK1 shRNA 8 | Homo sapiens | Ampicillin | PMID:21205641 | human ULK1 shRNA 8 TRC candidate. shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3' | Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:05 | 5 | |
|
human STIM1 YFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_19754 | STIM1 | Homo sapiens | Ampicillin | PMID:16921383 | See Author's Map for empty backbone (MO91) information. | Backbone Marker:See author's map; Backbone Size:6000; Vector Backbone:MO91; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 23 | |
|
pCDNA3 Flag MKK7B2Jnk1a1(APF) Resource Report Resource Website 10+ mentions |
RRID:Addgene_19730 | MKK7B2Jnk1a1(APF) | Homo sapiens | Ampicillin | PMID:12052897 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | replaced dual phosporylation motif Thr(1959)-Pro-Tyr(1965) with Ala-Pro-Phe | 2026-08-15 01:11:48 | 12 | |
|
pBabe puro RalA (long) wt Resource Report Resource Website |
RRID:Addgene_19717 | V-ral simian leukemia viral oncogene homolog A | Homo sapiens | Ampicillin | PMID:17174914 | Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | NOTE: long splice variant with 3bp deletion and 12bp insertion at 5' of gene. Long Sp. Variant: MVDYLAN Short Sp. Variant: MAAN | 2026-08-15 01:11:47 | 0 | |
|
pBabe puro RalA Q75L Resource Report Resource Website 1+ mentions |
RRID:Addgene_19719 | V-ral simian leukemia viral oncogene homolog A | Homo sapiens | Ampicillin | PMID:17174914 | Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | GTPase deficient & constitutively active Glutamine to Leucine at a.a. position 75. NOTE: long splice variant with 3bp deletion and 12bp insertion at 5' of gene. Long Sp. Variant: MVDYLAN Short Sp. Variant: MAAN | 2026-08-15 01:11:47 | 1 | |
|
pBabe puro RalB wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_19720 | V-ral simian leukemia viral oncogene homolog B | Homo sapiens | Ampicillin | PMID:17174914 | Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:47 | 1 | ||
|
pBabe puro RalB Q72L Resource Report Resource Website 1+ mentions |
RRID:Addgene_19721 | V-ral simian leukemia viral oncogene homolog B | Homo sapiens | Ampicillin | PMID:17174914 | Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Q72L constitutively active, GTPase Deficient | 2026-08-15 01:11:47 | 3 | |
|
pBabe puro RalA (short) wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_19723 | V-ral simian leukemia viral oncogene homolog A | Homo sapiens | Ampicillin | PMID:17174914 | Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | NOTE: short splice variant Long Sp. Variant: MVDYLAN Short Sp. Variant: MAAN | 2026-08-15 01:11:47 | 1 | |
|
pCDNA3 Flag MKK7B2Jnk1a1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_19726 | MKK7B2Jnk1a1 | Homo sapiens | Ampicillin | PMID:12052897 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 27 | ||
|
pCDNA3 Flag MKK7B2Jnk2a2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19727 | pCDNA3 FlagMKK7B2Jnk2a2 | Homo sapiens | Ampicillin | PMID:12052897 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 8 | ||
|
pBabe.puro.CDK8.flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_19758 | cyclin-dependent kinase 8 | Homo sapiens | Ampicillin | PMID:18794900 | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 2 | ||
|
pLKO.1.sh.beta-catenin.2279 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19762 | small hairpin RNA against beta-catenin | Homo sapiens | Ampicillin | PMID:18794900 | 2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is: CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT | Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 8 | |
|
pLV-tetO-myc T58A Resource Report Resource Website 1+ mentions |
RRID:Addgene_19763 | c-myc | Homo sapiens | Ampicillin | PMID:18371448 | From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site. | Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | T58A | 2026-08-15 01:11:48 | 4 |
|
psiCHECK RHEBL1 3'UTR Resource Report Resource Website |
RRID:Addgene_19858 | RHEBL1 3'UTR | Homo sapiens | Ampicillin | PMID:18978028 | There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct. | Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:49 | 0 | |
|
psiCHECK GSC 3'UTR Resource Report Resource Website |
RRID:Addgene_19859 | GSC 3'UTR | Homo sapiens | Ampicillin | PMID:18978028 | Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:49 | 0 | ||
|
psiCHECK SIRT4 3'UTR Resource Report Resource Website |
RRID:Addgene_19860 | SIRT4 3' UTR | Homo sapiens | Ampicillin | PMID:18978028 | Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:49 | 0 | ||
|
psiCHECK IRF9 3'UTR Resource Report Resource Website 1+ mentions |
RRID:Addgene_19863 | IRF9 3'UTR | Homo sapiens | Ampicillin | PMID:18978028 | There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct. | Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:49 | 1 | |
|
pQCXIP Flag-hRpt6 Resource Report Resource Website |
RRID:Addgene_19793 | hRpt6 | Homo sapiens | Ampicillin | PMID:18922472 | Backbone Marker:Clontech; Backbone Size:7700; Vector Backbone:pQCXIP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 0 | ||
|
BacPAK Flag-NFRKB 1-101 Resource Report Resource Website |
RRID:Addgene_19792 | NFRKB | Homo sapiens | Ampicillin | PMID:18922472 | Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | only contains amino acids 1-101 | 2026-08-15 01:11:48 | 0 | |
|
pcDNA5 HA-CCDC95 Resource Report Resource Website |
RRID:Addgene_19795 | CCDC95 | Homo sapiens | Ampicillin | PMID:18922472 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:48 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
