Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: human/zebrafish codon optimized SpCas9
Vector Backbone Description: Vector Backbone:BPK764 (Addgene Plasmid #65767); Vector Types:Bacterial Expression, in vitro transcription; T7 promoter; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36203014
Proper citation: RRID:Addgene_181745 Copy
Species: S. pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32101700
Proper citation: RRID:Addgene_181906 Copy
Species: Mus musculus
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32101700
Proper citation: RRID:Addgene_181904 Copy
Genetic Insert: MCP-M-MLV-RT
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35379962
Proper citation: RRID:Addgene_181799 Copy
Species: Synthetic
Genetic Insert: Rep2 and Ref2
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741
Proper citation: RRID:Addgene_182055 Copy
Species: Synthetic
Genetic Insert: Rep1 and Ref1
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741
Proper citation: RRID:Addgene_182054 Copy
Species: Synthetic
Genetic Insert: Rep6 and Ref6
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741
Proper citation: RRID:Addgene_182059 Copy
Species: Homo sapiens
Genetic Insert: RUNX1C (human)
Vector Backbone Description: Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36493345
Proper citation: RRID:Addgene_181980 Copy
Species: Vesicular Stomatitis Virus
Genetic Insert: VSVGmut
Vector Backbone Description: Backbone Size:4284; Vector Backbone:pMD2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35396484
Comments: Mutations originally described in Nikolic et al 2018: https://www.nature.com/articles/s41467-018-03432-4.
Proper citation: RRID:Addgene_182229 Copy
Species: Synthetic
Genetic Insert: cAMPFIRE-L-R279E (cAMP-deficient cAMPFIRE-L)
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.
Proper citation: RRID:Addgene_182282 Copy
Species: Synthetic
Genetic Insert: cAMPFIRE-M (cAMP sensor)
Vector Backbone Description: Backbone Size:5922; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.
Proper citation: RRID:Addgene_182284 Copy
Species: Synthetic
Genetic Insert: cAMPFIRE-L (cAMP sensor)
Vector Backbone Description: Backbone Size:5922; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.
Proper citation: RRID:Addgene_182283 Copy
Species: Homo sapiens
Genetic Insert: MYOD1-shOct4
Vector Backbone Description: Backbone Size:13225; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182309 Copy
Species: Brevibacillus sp. SYP-B805
Genetic Insert: BrCas12b
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35290826
Proper citation: RRID:Addgene_182276 Copy
Species: Synthetic
Genetic Insert: cAMPFIRE-L (cAMP sensor)
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.
Proper citation: RRID:Addgene_182279 Copy
Species: Synthetic
Genetic Insert: GFP 1-9 OPT
Vector Backbone Description: Backbone Marker:pEGFP (Clontech); Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24092409
Proper citation: RRID:Addgene_182244 Copy
Genetic Insert: mCherry-Fis1
Vector Backbone Description: Vector Backbone:pmCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778832
Proper citation: RRID:Addgene_182580 Copy
Species: Aggregatibacter actinomycetemcomitans
Genetic Insert: Dispersin B
Vector Backbone Description: Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35379435
Proper citation: RRID:Addgene_176577 Copy
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Proper citation: RRID:Addgene_176583 Copy
Species: Mus musculus
Genetic Insert: mVenus-p27K-
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34079127
Proper citation: RRID:Addgene_176651 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.