Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 396 showing 7901 ~ 7920 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/181745

Species: Synthetic
Genetic Insert: human/zebrafish codon optimized SpCas9
Vector Backbone Description: Vector Backbone:BPK764 (Addgene Plasmid #65767); Vector Types:Bacterial Expression, in vitro transcription; T7 promoter; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36203014

Proper citation: RRID:Addgene_181745 Copy   


  • RRID:Addgene_181906

    This resource has 1+ mentions.

http://www.addgene.org/181906

Species: S. pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32101700

Proper citation: RRID:Addgene_181906 Copy   


  • RRID:Addgene_181904

    This resource has 1+ mentions.

http://www.addgene.org/181904

Species: Mus musculus
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32101700

Proper citation: RRID:Addgene_181904 Copy   


  • RRID:Addgene_181799

    This resource has 1+ mentions.

http://www.addgene.org/181799

Genetic Insert: MCP-M-MLV-RT
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35379962

Proper citation: RRID:Addgene_181799 Copy   


  • RRID:Addgene_182055

    This resource has 1+ mentions.

http://www.addgene.org/182055

Species: Synthetic
Genetic Insert: Rep2 and Ref2
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741

Proper citation: RRID:Addgene_182055 Copy   


  • RRID:Addgene_182054

    This resource has 1+ mentions.

http://www.addgene.org/182054

Species: Synthetic
Genetic Insert: Rep1 and Ref1
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741

Proper citation: RRID:Addgene_182054 Copy   


  • RRID:Addgene_182059

    This resource has 1+ mentions.

http://www.addgene.org/182059

Species: Synthetic
Genetic Insert: Rep6 and Ref6
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35281741

Proper citation: RRID:Addgene_182059 Copy   


http://www.addgene.org/181980

Species: Homo sapiens
Genetic Insert: RUNX1C (human)
Vector Backbone Description: Vector Backbone:pRRL.PPT.SFFV.MCS.IRES.dTomato; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36493345

Proper citation: RRID:Addgene_181980 Copy   


  • RRID:Addgene_182229

    This resource has 1+ mentions.

http://www.addgene.org/182229

Species: Vesicular Stomatitis Virus
Genetic Insert: VSVGmut
Vector Backbone Description: Backbone Size:4284; Vector Backbone:pMD2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35396484
Comments: Mutations originally described in Nikolic et al 2018: https://www.nature.com/articles/s41467-018-03432-4.

Proper citation: RRID:Addgene_182229 Copy   


  • RRID:Addgene_182282

    This resource has 1+ mentions.

http://www.addgene.org/182282

Species: Synthetic
Genetic Insert: cAMPFIRE-L-R279E (cAMP-deficient cAMPFIRE-L)
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.

Proper citation: RRID:Addgene_182282 Copy   


  • RRID:Addgene_182284

    This resource has 1+ mentions.

http://www.addgene.org/182284

Species: Synthetic
Genetic Insert: cAMPFIRE-M (cAMP sensor)
Vector Backbone Description: Backbone Size:5922; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.

Proper citation: RRID:Addgene_182284 Copy   


  • RRID:Addgene_182283

    This resource has 1+ mentions.

http://www.addgene.org/182283

Species: Synthetic
Genetic Insert: cAMPFIRE-L (cAMP sensor)
Vector Backbone Description: Backbone Size:5922; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.

Proper citation: RRID:Addgene_182283 Copy   


  • RRID:Addgene_182309

    This resource has 1+ mentions.

http://www.addgene.org/182309

Species: Homo sapiens
Genetic Insert: MYOD1-shOct4
Vector Backbone Description: Backbone Size:13225; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182309 Copy   


  • RRID:Addgene_182276

    This resource has 1+ mentions.

http://www.addgene.org/182276

Species: Brevibacillus sp. SYP-B805
Genetic Insert: BrCas12b
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35290826

Proper citation: RRID:Addgene_182276 Copy   


  • RRID:Addgene_182279

    This resource has 1+ mentions.

http://www.addgene.org/182279

Species: Synthetic
Genetic Insert: cAMPFIRE-L (cAMP sensor)
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36303019
Comments: Please visit https://doi.org/10.1101/2021.08.27.457999 for bioRxiv preprint.

Proper citation: RRID:Addgene_182279 Copy   


  • RRID:Addgene_182244

    This resource has 1+ mentions.

http://www.addgene.org/182244

Species: Synthetic
Genetic Insert: GFP 1-9 OPT
Vector Backbone Description: Backbone Marker:pEGFP (Clontech); Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24092409

Proper citation: RRID:Addgene_182244 Copy   


  • RRID:Addgene_182580

    This resource has 1+ mentions.

http://www.addgene.org/182580

Genetic Insert: mCherry-Fis1
Vector Backbone Description: Vector Backbone:pmCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778832

Proper citation: RRID:Addgene_182580 Copy   


http://www.addgene.org/176577

Species: Aggregatibacter actinomycetemcomitans
Genetic Insert: Dispersin B
Vector Backbone Description: Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35379435

Proper citation: RRID:Addgene_176577 Copy   


  • RRID:Addgene_176583

    This resource has 1+ mentions.

http://www.addgene.org/176583

Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176583 Copy   


  • RRID:Addgene_176651

    This resource has 1+ mentions.

http://www.addgene.org/176651

Species: Mus musculus
Genetic Insert: mVenus-p27K-
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34079127

Proper citation: RRID:Addgene_176651 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X