Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Itk PR
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10636929
Comments: P158A P159A (adds a BspEI site). See author's map for more information.
Proper citation: RRID:Addgene_20708 Copy
Species: Mus musculus
Genetic Insert: Itk K390R
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10636929
Comments: K390R (adds an AvaII site). See author's map for more information.
Proper citation: RRID:Addgene_20707 Copy
Species: Mus musculus
Genetic Insert: Itk
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10636929
Comments: Wild-type Itk. See author's map for more information. The native stop codon of Itk was deleted and replaced with a PCR-derived fragment encoding a short linker peptide and a carboxyl-terminal Myc epitope tag. These modifications extend Itk by 21 amino acids (AGAEFMEQKLISEEDLRKFDI). EF/Itk-myc expression vectors were generated by inserting the modified Itk cDNA into a derivative of pEF-BOS.
Proper citation: RRID:Addgene_20705 Copy
Species: Mus musculus
Genetic Insert: Itk TEC
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10636929
Proper citation: RRID:Addgene_20711 Copy
Species: Mus musculus
Genetic Insert: Itk SH3*
Vector Backbone Description: Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10636929
Comments: W208K. See author's map for more information.
Proper citation: RRID:Addgene_20710 Copy
Species: Mus musculus
Genetic Insert: pGSTag Flag p38 alpha (agf)
Vector Backbone Description: Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9430721
Proper citation: RRID:Addgene_20816 Copy
Species: Mus musculus
Genetic Insert: p53AS
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pCSP1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17234915
Proper citation: RRID:Addgene_20904 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19299559
Proper citation: RRID:Addgene_20917 Copy
Species: Mus musculus
Genetic Insert: E12 cTAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19299559
Comments: The depositor noted that the E12 cTAP A218T mutation found in Addgene's quality control sequence does NOT affect plasmid function.
Proper citation: RRID:Addgene_20916 Copy
Species: Mus musculus
Genetic Insert: p21 3'UTR site 1 mutation
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978791
Proper citation: RRID:Addgene_20878 Copy
Species: Mus musculus
Genetic Insert: MyoD cTAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19299559
Proper citation: RRID:Addgene_20915 Copy
Species: Mus musculus
Genetic Insert: p21 3'UTR site 2 mutation
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978791
Proper citation: RRID:Addgene_20879 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: The 10-amino acid linker between the mouse Id1 and VenusYFP, GSAGSAAGSG, is derived from a linker described in Waldo et al., 1999 (https://www.ncbi.nlm.nih.gov/pubmed/10404163). The Venus cDNA was obtained from Dr. Anna-Katerina Hadjantonakis.
Proper citation: RRID:Addgene_20966 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19896442
Proper citation: RRID:Addgene_20963 Copy
Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Size:6500; Vector Backbone:MSCV-PGK-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18474618
Comments: Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag
The nucleotide sequence should not change the aa sequence.
Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.
Proper citation: RRID:Addgene_20976 Copy
Species: Mus musculus
Genetic Insert: HOXA9
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:5000; Vector Backbone:pGEX-4T-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10082572
Proper citation: RRID:Addgene_20974 Copy
Species: Mus musculus
Genetic Insert: Clathrin, light polypeptide (Lca)
Vector Backbone Description: Backbone Marker:Invitrogen cat#K480040; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15122347
Proper citation: RRID:Addgene_20921 Copy
Species: Mus musculus
Genetic Insert: p27 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978791
Proper citation: RRID:Addgene_20881 Copy
Species: Mus musculus
Genetic Insert: Rbl2 (p130) 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978791
Proper citation: RRID:Addgene_20885 Copy
Species: Mus musculus
Genetic Insert: Rbl1 (p107) 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978791
Proper citation: RRID:Addgene_20884 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
