Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Presenilin-associated rhomboid-like
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14732705
Proper citation: RRID:Addgene_13639 Copy
Species: Homo sapiens
Genetic Insert: CD14
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid was cloned by cut and paste from pCEP4-HuCD14 with
KpnI (5') and NotI (3').
Proper citation: RRID:Addgene_13645 Copy
Species: Homo sapiens
Genetic Insert: HEC1
Vector Backbone Description: Vector Backbone:pLenti-CMVtight-Hygro-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_136353 Copy
Species: Homo sapiens
Genetic Insert: Toll-Like Receptor 10
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pcDNA3-YFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
Proper citation: RRID:Addgene_13643 Copy
Species: Bacteroides fragilis 638R
Genetic Insert: Type VI effector bfe1
Vector Backbone Description: Backbone Size:2980; Vector Backbone:pExchange_tdk; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31712278
Proper citation: RRID:Addgene_136355 Copy
Vector Backbone Description: Vector Backbone:pDONR-U6gRNA-PGKpuro2ABFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29654229
Proper citation: RRID:Addgene_136409 Copy
Species: Homo sapiens
Genetic Insert: vimentin-emiRFP703
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31932632
Proper citation: RRID:Addgene_136566 Copy
Species: Homo sapiens
Genetic Insert: H2B-emiRFP670
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31932632
Proper citation: RRID:Addgene_136571 Copy
Species: Homo sapiens
Genetic Insert: PDGFRbeta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32559251
Proper citation: RRID:Addgene_136455 Copy
Species: Homo sapiens
Genetic Insert: NRF2
Vector Backbone Description: Backbone Marker:Addgene #1765; Backbone Size:5219; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32291314
Proper citation: RRID:Addgene_136579 Copy
Species: Homo sapiens
Genetic Insert: DNA Helicase B
Vector Backbone Description: Backbone Size:9136; Vector Backbone:CSII-EF-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24075009
Proper citation: RRID:Addgene_136461 Copy
Genetic Insert: HyPer7
Vector Backbone Description: Vector Backbone:-; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32130885
Proper citation: RRID:Addgene_136464 Copy
Genetic Insert: HyPer7
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32130885
Proper citation: RRID:Addgene_136467 Copy
Genetic Insert: HyPer7
Vector Backbone Description: Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32130885
Proper citation: RRID:Addgene_136468 Copy
Species: Other
Genetic Insert: Puromycin resistance
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32661438
Proper citation: RRID:Addgene_136474 Copy
Species: Other
Genetic Insert: AsCas12a
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32661438
Proper citation: RRID:Addgene_136475 Copy
Species: Other
Genetic Insert: HygroR-T2A-BlastR-P2A-PuroR-F2A-EGFP
Vector Backbone Description: Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32661438
Proper citation: RRID:Addgene_136477 Copy
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:32291314
Proper citation: RRID:Addgene_136519 Copy
Species: Homo sapiens
Genetic Insert: NRF2(1584A>C,1586A>T,1589A>G)
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:32291314
Proper citation: RRID:Addgene_136522 Copy
Species: Firefly
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Marker:Addgene #25737; Backbone Size:13286; Vector Backbone:pSLIK-hygro; Vector Types:Mammalian Expression, Lentiviral, destinatioin vector for gateway cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32291314
Proper citation: RRID:Addgene_136528 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
