Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
LZRS ERTm RasN17
 
Resource Report
Resource Website 		RRID:Addgene_21198 HRas Homo sapiens Ampicillin PMID:11896581 Backbone Size:11100; Vector Backbone:LZRS no LacZ; Vector Types:Retroviral; Bacterial Resistance:Ampicillin S17N ERTm bx3 2026-08-15 01:12:00 0
LZRS-Mek2-K101A (KA7)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21191 Mek2 Homo sapiens Ampicillin Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin K101A (catalytically inactive) 2026-08-15 01:12:00 2
LZRS-Mek1-wt1 (wt1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21196 Mek1 Homo sapiens Ampicillin Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:00 2
L2E-2
 
Resource Report
Resource Website 		RRID:Addgene_21194 Mek2 Homo sapiens Ampicillin PMID:15342384 Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin deletion of residues EQQKKRLE, S222D S226D in Mek2; constitutive active Mek2 fused to ER* 2026-08-15 01:12:00 0
KW1
 
Resource Report
Resource Website 		RRID:Addgene_21211 Mek2 Homo sapiens Kanamycin PMID:15342384 Constitutive active protein has the following aa sequence deleted - EQQKKRLE, residues 48 to 55. Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin KW71, constitutive active 2026-08-15 01:12:00 0
PGK-H2BeGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21210 Phosphoglycerate kinase promoter Homo sapiens Ampicillin PMID:19352491 There are several mismatches between depositor's and Addgene sequence. These mutations do not affect eGFP expression. Backbone Size:7226; Vector Backbone:SIN18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:00 15
MSCV JMJD3 mutant
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21214 JMJD3 Homo sapiens Ampicillin PMID:18628393 Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin H1390A 2026-08-15 01:12:01 7
MSCV JMJD3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21212 JMJD3 Homo sapiens Ampicillin PMID:18628393 Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:01 9
pGL3-Control-E2F-3'UTR-Mut
 
Resource Report
Resource Website 		RRID:Addgene_21171 E2F 3'UTR Mutant Homo sapiens Ampicillin PMID:15944709 Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2 miR binding sites mutated. Changed from GCACTTT to GGAGTGT. 2026-08-15 01:12:00 0
pGL3b(1454/3172)P2P-wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21404 EGLN1 Homo sapiens Ampicillin PMID:15563275 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:12:02 1
pLKO.1 shMTH1-2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21298 shMTH1-2 Homo sapiens Ampicillin PMID:19118192 shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:01 2
pLKO.1 shMTH1-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21297 shMTH1-1 Homo sapiens Ampicillin PMID:19118192 shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′. Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:01 2
pLKO human shRNA 2 DEPTOR
 
Resource Report
Resource Website 		RRID:Addgene_21336 DEPTOR shRNA 2 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 2 TRC candidate; NM_022783.1-1101s1c1 shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:02 0
pLKO human shRNA 1 DEPTOR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21335 DEPTOR shRNA 1 Homo sapiens Ampicillin PMID:19446321 human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:12:02 1
pBabe puro MTH1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21295 MTH1 Homo sapiens Ampicillin PMID:19118192 The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector. Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:01 1
pTOPO-MCL1S159A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21606 MCL-1 S159A Homo sapiens Ampicillin PMID:16543145 Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1 /V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Serine 159 mutated to Alanine, abolishing phosphorylation by GSK-3. Insert ends with a STOP codon, no V5-His-tag. 2026-08-15 01:12:03 2
NHA-Ago4
 
Resource Report
Resource Website 		RRID:Addgene_21537 Ago4 Homo sapiens Ampicillin PMID:19324964 Backbone Size:5500; Vector Backbone:pCl-neo_NHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:03 0
GST-GW1D10(aa566-1343)
 
Resource Report
Resource Website 		RRID:Addgene_21516 TNRC6A Homo sapiens Ampicillin PMID:19324964 Backbone Size:7000; Vector Backbone:pCG-GST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa566-1343 2026-08-15 01:12:03 0
GFP-GW1D5(aa1670-1962)
 
Resource Report
Resource Website 		RRID:Addgene_21519 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa1670-1962 2026-08-15 01:12:03 0
GFP-D1a_W3-4(aa340-439)
 
Resource Report
Resource Website 		RRID:Addgene_21526 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa340-439 2026-08-15 01:12:03 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch