Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEF Itk P158A P159A myc Resource Report Resource Website |
RRID:Addgene_20708 | Itk PR | Mus musculus | Ampicillin | PMID:10636929 | P158A P159A (adds a BspEI site). See author's map for more information. | Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P158A P159A. Inactivates the proline-rich region. | 2026-08-29 01:02:01 | 0 |
|
pEF Itk K390R myc Resource Report Resource Website |
RRID:Addgene_20707 | Itk K390R | Mus musculus | Ampicillin | PMID:10636929 | K390R (adds an AvaII site). See author's map for more information. | Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Kinase Dead. K390R. | 2026-08-29 01:01:58 | 0 |
|
pEF Itk myc Resource Report Resource Website |
RRID:Addgene_20705 | Itk | Mus musculus | Ampicillin | PMID:10636929 | Wild-type Itk. See author's map for more information. The native stop codon of Itk was deleted and replaced with a PCR-derived fragment encoding a short linker peptide and a carboxyl-terminal Myc epitope tag. These modifications extend Itk by 21 amino acids (AGAEFMEQKLISEEDLRKFDI). EF/Itk-myc expression vectors were generated by inserting the modified Itk cDNA into a derivative of pEF-BOS. | Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:56 | 0 | |
|
pGEX Itk TEC Resource Report Resource Website |
RRID:Addgene_20711 | Itk TEC | Mus musculus | Ampicillin | PMID:10636929 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | amino acids 97-174 | 2026-08-29 01:02:01 | 0 | |
|
pEF Itk W208K myc Resource Report Resource Website |
RRID:Addgene_20710 | Itk SH3* | Mus musculus | Ampicillin | PMID:10636929 | W208K. See author's map for more information. | Backbone Size:0; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | W208K. Inactivates binding pocket of SH3 domain. | 2026-08-29 01:01:58 | 0 |
|
pGSTag Flag p38 alpha (agf) Resource Report Resource Website |
RRID:Addgene_20816 | pGSTag Flag p38 alpha (agf) | Mus musculus | Ampicillin | PMID:9430721 | Backbone Size:5057; Vector Backbone:pGSTag; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Replace Thr 180 and Tyr 182 with Ala and Phe respectivly | 2026-08-29 01:02:02 | 0 | |
|
pCSP1-mp53AS-6xMUT Resource Report Resource Website |
RRID:Addgene_20904 | p53AS | Mus musculus | Ampicillin | PMID:17234915 | Backbone Size:4800; Vector Backbone:pCSP1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | point mutation (Ser/Thr-Ala) of the 6 N-terminal phosphorylated residues (S4, S6, S9, S15, T18, S20). 5' natural EcoRV and SacI restriction sites eliminated for mutagenesis purposes. | 2026-08-29 01:01:59 | 0 | |
|
MyoD-pCLBabe Resource Report Resource Website 1+ mentions |
RRID:Addgene_20917 | MyoD | Mus musculus | Ampicillin | PMID:19299559 | Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:59 | 6 | ||
|
E12-cTAP Resource Report Resource Website 1+ mentions |
RRID:Addgene_20916 | E12 cTAP | Mus musculus | Ampicillin | PMID:19299559 | The depositor noted that the E12 cTAP A218T mutation found in Addgene's quality control sequence does NOT affect plasmid function. | Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | TAP tag is fused to the 3' end of the E12 gene. Mutation A218T (please see depositor's comment below) | 2026-08-29 01:01:57 | 1 |
|
pGL-p21UTRm1 Resource Report Resource Website |
RRID:Addgene_20878 | p21 3'UTR site 1 mutation | Mus musculus | Ampicillin | PMID:18978791 | Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Predicted miRNA binding site 1 (Position ~420) GCACTTT to GCAATGT | 2026-08-29 01:01:59 | 0 | |
|
MyoD-cTAP Resource Report Resource Website |
RRID:Addgene_20915 | MyoD cTAP | Mus musculus | Ampicillin | PMID:19299559 | Backbone Size:4500; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | TAP tag is fused to the 3' end of the MyoD sequence | 2026-08-29 01:02:02 | 0 | |
|
pGL-p21UTRm2 Resource Report Resource Website |
RRID:Addgene_20879 | p21 3'UTR site 2 mutation | Mus musculus | Ampicillin | PMID:18978791 | Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Predicted miRNA binding site 2 (Position ~1100) GCACTTA to GCCCGTA | 2026-08-29 01:02:02 | 0 | |
|
mId1-Venus Resource Report Resource Website 1+ mentions |
RRID:Addgene_20966 | Inhibitor of DNA binding 1 | Mus musculus | Ampicillin | PMID:19896442 | The 10-amino acid linker between the mouse Id1 and VenusYFP, GSAGSAAGSG, is derived from a linker described in Waldo et al., 1999 (https://www.ncbi.nlm.nih.gov/pubmed/10404163). The Venus cDNA was obtained from Dr. Anna-Katerina Hadjantonakis. | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:03 | 1 | |
|
GFP-mId1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_20963 | Inhibitor of DNA binding 1 | Mus musculus | Kanamycin | PMID:19896442 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:03 | 1 | ||
|
HOXA9-micro-MSCV Resource Report Resource Website |
RRID:Addgene_20976 | HOXA9 | Mus musculus | Ampicillin | PMID:18474618 | Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag The nucleotide sequence should not change the aa sequence. Has ribosomal recognition site (ACC) in front of the ATG protein coding start site. | Backbone Size:6500; Vector Backbone:MSCV-PGK-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Mutations to remove binding sites for miR-145, let-7, and miR-126 in homeobox. | 2026-08-29 01:02:00 | 0 |
|
HOXA9-pGEX Resource Report Resource Website |
RRID:Addgene_20974 | HOXA9 | Mus musculus | Ampicillin | PMID:10082572 | Backbone Marker:Pharmacia; Backbone Size:5000; Vector Backbone:pGEX-4T-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:03 | 0 | ||
|
EYFP-Clathrin Resource Report Resource Website 1+ mentions |
RRID:Addgene_20921 | Clathrin, light polypeptide (Lca) | Mus musculus | Ampicillin | PMID:15122347 | Backbone Marker:Invitrogen cat#K480040; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:57 | 4 | ||
|
pGL-p27UTR Resource Report Resource Website 1+ mentions |
RRID:Addgene_20881 | p27 3'UTR | Mus musculus | Ampicillin | PMID:18978791 | Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:59 | 2 | ||
|
pGL-Rbl2 Resource Report Resource Website |
RRID:Addgene_20885 | Rbl2 (p130) 3'UTR | Mus musculus | Ampicillin | PMID:18978791 | Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:02 | 0 | ||
|
pGL-Rbl1UTR Resource Report Resource Website |
RRID:Addgene_20884 | Rbl1 (p107) 3'UTR | Mus musculus | Ampicillin | PMID:18978791 | Backbone Marker:Promega; Backbone Size:5256; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:59 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
