Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX-5x3-hMeCP2-delN256-G273X Resource Report Resource Website |
RRID:Addgene_48090 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted the N-terminal 256 codons, expresses AT-Hook G273X | 2026-08-29 01:06:13 | 0 | |
|
pTXB1-hMeCP2-R270X Resource Report Resource Website |
RRID:Addgene_48092 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Mxe intein/chitin binding domain tagged, expresses AT-Hook R270X | 2026-08-29 01:06:13 | 0 | |
|
pCMX-Gal4-hMeCP2-R270X-R111G Resource Report Resource Website |
RRID:Addgene_48086 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R111G mutant MeCP2, expresses AT-hook R270X | 2026-08-29 01:06:13 | 0 | |
|
pCMX-Gal4-hMeCP2-G273X Resource Report Resource Website |
RRID:Addgene_48084 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | expresses AT-Hook G273X | 2026-08-29 01:06:13 | 0 | |
|
pSPPac-hp Resource Report Resource Website |
RRID:Addgene_48123 | signal peptide of Pac | Ampicillin | PMID:20435764 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:13 | 0 | |||
|
pSPYngK+-hp Resource Report Resource Website |
RRID:Addgene_48121 | codon optimized signal peptide of YngK | Ampicillin | PMID:20435764 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:13 | 0 | |||
|
pGEX-5x3-hMeCP2-delN256-R270X Resource Report Resource Website |
RRID:Addgene_48089 | Methyl-CpG Binding Protein 2 (Rett Syndrome) | Homo sapiens | Ampicillin | PMID:23452848 | Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted the N-terminal 256 codons, expresses AT-Hook R270X | 2026-08-29 01:06:13 | 0 | |
|
pAC152-dual-dCas9VP64-sgExpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_48238 | dCas9 | Synthetic | Ampicillin | PMID:23979020 | Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A;H840A | 2026-08-29 01:06:14 | 3 |
|
IpO Resource Report Resource Website 1+ mentions |
RRID:Addgene_48233 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-08-29 01:06:14 | 1 | |
|
pAC103-PBNeo-U6-sgRNA-Expression Resource Report Resource Website |
RRID:Addgene_48228 | Ampicillin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 | |||
|
pTrex-Luc-Neo Resource Report Resource Website |
RRID:Addgene_48336 | firely luciferase | Photinus pyralis | Ampicillin | PMID:29578409 | Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:15 | 0 | ||
|
pTrex-Luc-Phleo Resource Report Resource Website 1+ mentions |
RRID:Addgene_48337 | firely luciferase | Photinus pyralis | Ampicillin | PMID:20644616 | Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:15 | 2 | ||
|
5HT6-YC3.60 Resource Report Resource Website |
RRID:Addgene_48339 | 5-hydroxytriptamine receptor isoform 6 | Mus musculus | Ampicillin | PMID:24056873 | Backbone Size:5300; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:15 | 0 | ||
|
pET MYFQSNA tagged cloning vector with BioBrick polycistronic restriction sites (9U) Resource Report Resource Website |
RRID:Addgene_48293 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a MYFQSNA fusion tag on the N-terminus To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA. | Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 | ||||
|
Gal1/10 His6-MBP TEV Ade S. cerevisiae expression vector (12ADE-C) Resource Report Resource Website |
RRID:Addgene_48299 | Ampicillin | Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ade auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:9643; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 | ||||
|
CAG-Flex-TCB Resource Report Resource Website 10+ mentions |
RRID:Addgene_48332 | TVA receptor mCherry | Ampicillin | PMID:24239125 | Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:15 | 32 | |||
|
pFastBac StrepII msfGFP TEV cloning vector with BioBrick polycistronic restriction sites(11R-GFP) Resource Report Resource Website |
RRID:Addgene_48297 | Ampicillin | PMID:28668116 | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable StrepII-msfGFP tag on the N-terminus. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 11 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. For more information, please see our website: https://macrolab.qb3.berkeley.edu/dna-cloning/ | Backbone Size:6148; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 | |||
|
CAG-Flex-TC66T Resource Report Resource Website 10+ mentions |
RRID:Addgene_48331 | TVA receptor mCherry fusion with the 66T mutation | Ampicillin | PMID:24239125 | Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 66T | 2026-08-29 01:06:15 | 11 | ||
|
pET StrepII TEV cloning vector with BioBrick polycistronic restriction sites (9R) Resource Report Resource Website |
RRID:Addgene_48290 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminusTo clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4774; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 | ||||
|
pBAD empty polycistronic destination vector (8D) Resource Report Resource Website |
RRID:Addgene_48282 | Ampicillin | This plasmid is an empty destination vector. It is a polycistronic vector that can express up to five genes at once. Genes must first be cloned into any of our 8-series transfer vectors (8BT,8CT,8UT), then subcloned into any of the five cassettes of the destination vector: Cassette 1: BamHI/XbaI Cassette 2: AsiSI/PspXI Cassette 3: SbfI/AscI Cassette 4: AdeI/NotI Cassette 5: PacI/FseI Please note that you must always insert your gene into the lowest cassette number first (e.g., if you're using cassettes 2 and 3, you must put your gene into cassette 2 first, then move on to cassette 3). You do not have to use all of the cassettes. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5767; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:06:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
