Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 4 showing 61 ~ 80 out of 228 results
Snippet view Table view Download 228 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_194154

http://www.addgene.org/194154

Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092

Proper citation: RRID:Addgene_194154 Copy   


  • RRID:Addgene_194155

http://www.addgene.org/194155

Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092

Proper citation: RRID:Addgene_194155 Copy   


  • RRID:Addgene_61565

    This resource has 1+ mentions.

http://www.addgene.org/61565

Vector Backbone Description: Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Synthetic Biology, Mini-Tn5 vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25389526

Proper citation: RRID:Addgene_61565 Copy   


  • RRID:Addgene_62247

http://www.addgene.org/62247

Species: Other
Genetic Insert: mRFP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25422271

Proper citation: RRID:Addgene_62247 Copy   


  • RRID:Addgene_62248

http://www.addgene.org/62248

Species: Other
Genetic Insert: mRFP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25422271

Proper citation: RRID:Addgene_62248 Copy   


  • RRID:Addgene_62250

http://www.addgene.org/62250

Species: Other
Genetic Insert: mRFP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25422271

Proper citation: RRID:Addgene_62250 Copy   


  • RRID:Addgene_62251

http://www.addgene.org/62251

Species: Other
Genetic Insert: mRFP
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25422271

Proper citation: RRID:Addgene_62251 Copy   


  • RRID:Addgene_81053

    This resource has 1+ mentions.

http://www.addgene.org/81053

Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196

Proper citation: RRID:Addgene_81053 Copy   


  • RRID:Addgene_81054

    This resource has 1+ mentions.

http://www.addgene.org/81054

Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196

Proper citation: RRID:Addgene_81054 Copy   


  • RRID:Addgene_98417

    This resource has 1+ mentions.

http://www.addgene.org/98417

Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).

Proper citation: RRID:Addgene_98417 Copy   


  • RRID:Addgene_89730

http://www.addgene.org/89730

Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137

Proper citation: RRID:Addgene_89730 Copy   


  • RRID:Addgene_89732

http://www.addgene.org/89732

Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137

Proper citation: RRID:Addgene_89732 Copy   


  • RRID:Addgene_89731

http://www.addgene.org/89731

Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137

Proper citation: RRID:Addgene_89731 Copy   


  • RRID:Addgene_89727

http://www.addgene.org/89727

Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137

Proper citation: RRID:Addgene_89727 Copy   


  • RRID:Addgene_89729

http://www.addgene.org/89729

Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137

Proper citation: RRID:Addgene_89729 Copy   


http://www.addgene.org/190273

Species: Vibrio cholera
Genetic Insert: VchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(BsaI)
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34478496

Proper citation: RRID:Addgene_190273 Copy   


  • RRID:Addgene_200216

http://www.addgene.org/200216

Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200216 Copy   


  • RRID:Addgene_200217

http://www.addgene.org/200217

Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200217 Copy   


  • RRID:Addgene_207528

    This resource has 1+ mentions.

http://www.addgene.org/207528

Genetic Insert: plasmid for adenine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgRNA
Vector Backbone Description: Backbone Marker:SEVA collection; Vector Backbone:pSEVA448; Vector Types:CRISPR, Pseudomonas vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:38180826

Proper citation: RRID:Addgene_207528 Copy   


  • RRID:Addgene_200218

http://www.addgene.org/200218

Species: Pseudomonas aeruginosa PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200218 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X