Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30315081
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint.
Proper citation: RRID:Addgene_118225 Copy
Species: Synthetic
Genetic Insert: flagellin promoter driven mCherry
Vector Backbone Description: Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30315081
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint.
Proper citation: RRID:Addgene_118230 Copy
Species: jellyfish
Genetic Insert: gfpmut 3.1
Vector Backbone Description: Backbone Size:4768; Vector Backbone:pBBRMCS5; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:22820336
Comments: GenBank accession number: JQ895027
pLMB509 contains GFPmut3.1 reporter gene downstream of the inducible promoter tauAp and a ribosomal binding site (RBS), followed by a six-His tag and a transcriptional stop codon. NdeI restriction sites flank the reporter gene, enabling the easy removal of gfpmut3.1 and subsequent replacement with the desired gene in frame.
This plasmid is compatible with BD In-Fusion cloning (Clontech) for the cloning of genes containing NdeI restriction sites
Proper citation: RRID:Addgene_40084 Copy
Species: Synechococcus elongatus PCC 7942
Genetic Insert: Gm cassette (BssHII+SphI)
Vector Backbone Description: Vector Backbone:pAM1303; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:18353436
Comments: NS1 vector
Gm resistant version of pAM1303.
Both pAM1303 and pAM3511 were digested with BssHII and SphI, and then mix-ligated. The accC1gene (Gm) replaces the aadA gene (SpSm) in the Ω cassette. The upstream T4 terminator was lost due to SphI digestion.
Proper citation: RRID:Addgene_40252 Copy
Species: Other
Genetic Insert: NSP1 124A/125A
Vector Backbone Description: Vector Backbone:pDONR207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33080218
Proper citation: RRID:Addgene_164523 Copy
Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178074 Copy
Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178071 Copy
Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178072 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG
Proper citation: RRID:Addgene_178077 Copy
Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178075 Copy
Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178076 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178067 Copy
Species: Synthetic
Genetic Insert: DsRed-Express2
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29449848
Comments: Please note that Addgene NGS results identified a 963T>A mutation in first FRT site compared to the depositing lab's sequence. The effect of this variant on FLP recombination efficiency is unknown.
Proper citation: RRID:Addgene_111260 Copy
Species: Synthetic
Genetic Insert: mTurquoise2
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18T-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29449848
Comments: Please note that Addgene NGS results identified a 963T>A mutation in first FRT site compared to the depositing lab's sequence. The effect of this variant on FLP recombination efficiency is unknown.
Proper citation: RRID:Addgene_111259 Copy
Species: Homo sapiens
Genetic Insert: PARP1
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30013063
Proper citation: RRID:Addgene_111573 Copy
Species: Synthetic
Genetic Insert: PA1/04/03-eyfp
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:12791135
Proper citation: RRID:Addgene_111620 Copy
Species: Synthetic
Genetic Insert: PcdrA-RBSII-gfp(ASV)-T0-T1
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:22582064
Proper citation: RRID:Addgene_111617 Copy
Species: Synthetic
Genetic Insert: PpqsA-gfp(ASV)
Vector Backbone Description: Vector Backbone:pUCP22Not; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17464046
Comments: GFP(AAV)- GFP variant with a shorter half life.
Proper citation: RRID:Addgene_111618 Copy
Species: Synthetic
Genetic Insert: PA1/04/03-ecfp
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:12791135
Proper citation: RRID:Addgene_111619 Copy
Species: Homo sapiens
Genetic Insert: Hook3(1-552)-GFP
Vector Backbone Description: Backbone Size:2857; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29420470
Comments: Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_111861 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
