Plasmids   Select Another Resource Report Type

http://www.addgene.org/62078

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = aspC tyrB trpA trpB Precursor strain = RF4 modified from the parent Escherichia coli BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asp++++, Tyr, Trp, (Phe) ++++RF4, RF5, and RF13 strains have knockouts in both aspC and tyrB genes and therefore require the presence of L-Asp (but not L-Glu) for growth in M63 minimal medium. These strains can be used for selective labeling of selected aromatic amino acid(s) such as Tyr (RF4, RF5, RF13) and/or Trp (RF13). We have NOT tested if these strains could also be used for selective Asp labeling studies (under investigation). Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62078 Copy   

•   Source: Addgene
  

http://www.addgene.org/62074

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = proC Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Pro Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62074 Copy   

•   Source: Addgene
  

http://www.addgene.org/62075

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26577727
Comments: Genotype = asnA asnB Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Asn Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_62075 Copy   

•   Source: Addgene
  

http://www.addgene.org/62820

Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26261213
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ + Dhfq

Proper citation: RRID:Addgene_62820 Copy   

•   Source: Addgene
  

http://www.addgene.org/63667

Genetic Insert: see comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26261213
Comments: MG1655 + lacIq intergrated at intS + ΔglmZ

Proper citation: RRID:Addgene_63667 Copy   

•   Source: Addgene
  

http://www.addgene.org/65915

Genetic Insert: MG1655 Z1 malE
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26900850
Comments: F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE-

Proper citation: RRID:Addgene_65915 Copy   

•   Source: Addgene
  

http://www.addgene.org/67755

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:26251500
Comments: The genotype of the strain relative to MG1655 is complex, since there are many single nucleotide variations and several 10-20kb differences (Brown & Jun (2015) Genome Announcements, Lyons et. al. (2011) PLoS ONE). There are a particular abundance of differences in the rDNA operons, which in several cases align more closely to E. coli strains DH10B, MDS42, and W. Particularly relevant genotypes are: λ+ gal+ eut+ pyrE+ ilvG+ rpoS33Am glnV(SupAm) evgA::IS1 Δrfb

Proper citation: RRID:Addgene_67755 Copy   

•   Source: Addgene
  

http://www.addgene.org/69778

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69778 Copy   

•   Source: Addgene
  

http://www.addgene.org/69775

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69775 Copy   

•   Source: Addgene
  

http://www.addgene.org/69774

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69774 Copy   

•   Source: Addgene
  

http://www.addgene.org/69782

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69782 Copy   

•   Source: Addgene
  

http://www.addgene.org/69781

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69781 Copy   

•   Source: Addgene
  

http://www.addgene.org/72402

Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26315440
Comments: No antibiotic resistance.

Proper citation: RRID:Addgene_72402 Copy   

•   Source: Addgene
  

http://www.addgene.org/78552

Genetic Insert: pTet--Cas9 cassette integrated at 186 primary attB site
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:27060147

Proper citation: RRID:Addgene_78552 Copy   

•   Source: Addgene
  

http://www.addgene.org/83379

Species: Mus musculus
Genetic Insert: Forkhead box O1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None

Proper citation: RRID:Addgene_83379 Copy   

•   Source: Addgene
  

http://www.addgene.org/21875

Genetic Insert: CSH100 bacterial Strain
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:19798082
Comments: F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html).

Proper citation: RRID:Addgene_21875 Copy   

•   Source: Addgene
  

http://www.addgene.org/191530

Species: E.coli
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)

Proper citation: RRID:Addgene_191530 Copy   

•   Source: Addgene
  

http://www.addgene.org/132780

Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33536221
Comments: Genotype: W3110 ∆waaL ∆lpxM

Proper citation: RRID:Addgene_132780 Copy   

•   Source: Addgene
  

http://www.addgene.org/172602

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:34369028
Comments: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/.  The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)].  The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site.  The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.

Proper citation: RRID:Addgene_172602 Copy   

•   Source: Addgene
  

http://www.addgene.org/188474

Genetic Insert: P-R-lox-TT-lox-bla
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188474 Copy   

•   Source: Addgene