Plasmids   Select Another Resource Report Type

http://www.addgene.org/160261

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160261 Copy   

•   Source: Addgene

http://www.addgene.org/160262

Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:32955754
Comments: Addgene NGS was unable to completely resolve all bases in the CloDF13 Origin. The plasmid has been successfully propagated at Addgene and these ambiguous bases do not appear to have a functional impact on the plasmid

Proper citation: RRID:Addgene_160262 Copy   

•   Source: Addgene

http://www.addgene.org/70284

Species: Other
Genetic Insert: Transposon Tn5-692
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:12218043
Comments: Tn5 derivative Tn5-692 (in plasmid pRL692; GenBank accession no. AF424805) contains a pMB1 oriV; and bears mutations (Zhou, et al. 1998 J. Mol. Biol. 276:913–925) that increase its rate of transposition ca. 100-fold relative to that of Tn5-1058 (Wolk, et al. 1991. Proc. Natl. Acad. Sci. USA 88:5355–5359), providing large numbers of transposon mutants. The erythromycin-resistance gene came from Horinouchi and Weisblum (J. Bacteriol. 150: 804-814, 1982) and the streptomycin-spectinomycin gene came from the Ω-fragment described by Prentki and Krisch (Gene 29, 303-313, 1984) and was purchased as an EcoRI fragment from Amersham. NOTE--Because Tn5-692 appears able to transpose repeatedly, the user is cautioned not to delay storing strains whose phenotype is of interest. Additional references: Miyagishima S-y, Wolk CP, Osteryoung KW (2005) Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol Microbiol 56: 126-143

Proper citation: RRID:Addgene_70284 Copy   

•   Source: Addgene

http://www.addgene.org/70692

Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial shuttle vector; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:17639350
Comments: MCS: (PT7→)HindIII-SphI-PstI(SbfI)-SalI(HincII)-KpnI-SacI-EcoRI-ClaI-ApaI-SacII-NsiI-NdeI-BglII-AflII-StuI-AvrII-XbaI-AatII-BsiWI-XhoI(PspXI)-SrfI-AscI-RsrII-BamHI(←PSP6)

Proper citation: RRID:Addgene_70692 Copy   

•   Source: Addgene

http://www.addgene.org/190156

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:36129831

Proper citation: RRID:Addgene_190156 Copy   

•   Source: Addgene

http://www.addgene.org/198421

Species: Synthetic
Genetic Insert: RedNTF
Vector Backbone Description: Vector Backbone:pGreen; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:36550363

Proper citation: RRID:Addgene_198421 Copy   

•   Source: Addgene

http://www.addgene.org/193370

Vector Backbone Description: Vector Backbone:pK7WG2; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40083573
Comments: Multisite Gateway destination vector to express ORFs from entry clones. RPS5A promoter and SV40 nuclear localization signal in front of attR1. HSP terminator at the downstream of attR5. Kanamycin-resistant gene and Ole1-GFP for screening of transformants. Please visit https://doi.org/10.1101/2023.02.27.530312 for bioRxiv preprint.

Proper citation: RRID:Addgene_193370 Copy   

•   Source: Addgene

http://www.addgene.org/216387

Species: Mus musculus
Genetic Insert: Dishevelled-2
Vector Backbone Description: Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35998232

Proper citation: RRID:Addgene_216387 Copy   

•   Source: Addgene

http://www.addgene.org/216386

Species: Mus musculus
Genetic Insert: Dishevelled-2
Vector Backbone Description: Backbone Marker:Novagen/EMD Biosciences; Vector Backbone:pCDFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35998232

Proper citation: RRID:Addgene_216386 Copy   

•   Source: Addgene

http://www.addgene.org/218172

Species: Other
Genetic Insert: TALE-Intron-hA3A-Y130F-DddA full (E1347A)-UGI
Vector Backbone Description: Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38709858

Proper citation: RRID:Addgene_218172 Copy   

•   Source: Addgene

http://www.addgene.org/218174

Species: Other
Genetic Insert: TALE-Intron-N-DddAtox half (G1397N)-UGI-T2A-TALE-C-DddAtox half (G1397C)-UGI
Vector Backbone Description: Vector Backbone:pYPQ121; Vector Types:Plant Expression, Plastid base editing; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38709858

Proper citation: RRID:Addgene_218174 Copy   

•   Source: Addgene

http://www.addgene.org/221134

Species: Synthetic
Genetic Insert: [PibpA-gfpASV]
Vector Backbone Description: Backbone Marker:Standard European Vector Architecture; Vector Backbone:pSEVA631; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:38676700

Proper citation: RRID:Addgene_221134 Copy   

•   Source: Addgene

http://www.addgene.org/200213

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200213 Copy   

•   Source: Addgene

http://www.addgene.org/200214

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200214 Copy   

•   Source: Addgene

http://www.addgene.org/200215

Species: Pseudomonas aeruginosa UCBPP-PA14
Genetic Insert: PaCas1, PaCas2-3
Vector Backbone Description: Backbone Size:2819; Vector Backbone:2S; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:37710013

Proper citation: RRID:Addgene_200215 Copy   

•   Source: Addgene

http://www.addgene.org/40248

Species: Synechococcus elongatus PCC 7942
Genetic Insert: One Step Cloneing Vector for Overexpression
Vector Backbone Description: Vector Backbone:pAM2990; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:15775978
Comments: pAM2990 was partially digested with SacI and re-ligatedto remove the antihel fragment. The net result is the insertion of the BglII fragment from pAM2255 into BamHI digested pAM1303 in the orientation that Ptrc goes away from the SacI site in pAM1303 (SacI digestion gives a 1.7 KB band). This plasmid can be used as a one-step cloning vector for overexpression.

Proper citation: RRID:Addgene_40248 Copy   

•   Source: Addgene

http://www.addgene.org/239460

Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Comments: For cloning a promoter + gene fragment (without stop codon) via Gibson Assembly, we recommend the following approach: Primer design: Forward primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC PRIMER 3’ Reverse primer:  5’ CAGAACCACCACCTCCGGATCC+GENE SPECIFIC PRIMER W/O STOP CODON 3' Digest pMDS1 plasmid with SAP I enzyme Clean up Perform Gibson assembly reaction Transform E. coli (DH5alpha) Select on LB + Sp + Sm

Proper citation: RRID:Addgene_239460 Copy   

•   Source: Addgene

http://www.addgene.org/239459

Vector Backbone Description: Vector Backbone:pMCY2; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:40864707
Comments: Two cloning steps are required for the generation of a "promoter:3xHA:VENUS:GENE:2A:mTurqN7" fragment: A) Cloning of promoter: Primer design: Forward Primer: 5’GATCGGGGCGCGCCCTCGAG+PROMOTER SPECIFIC SEQUENCE 3’ Reverse primer: 5’ GATGGGCATTAACATCTTTTAC+PROMOTER SPECIFIC SEQUENCE 3' Digest plasmid with SapI Clean Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm (blue/white selection) B) Cloning of gene fragment: Forward Primer: 5’GTTCTGGTGGGGGTGGCTCC+ GENE SPECIFIC SEQUENCE (starting from the ATG) 3’ Reverse primer:  5’ AACAGCTGGCCCGAGCCACC+GENE SPECIFIC SEQUENCE (without STOP Codon) 3' Digest plasmid with Bsu36I and perform gel purification Perform Gibson Assembly Transform E. coli and select positive colonies LB+Sp/Sm The discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.

Proper citation: RRID:Addgene_239459 Copy   

•   Source: Addgene

http://www.addgene.org/187872

Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Keunsub Lee; Backbone Size:6149; Vector Backbone:pTF505; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35690588

Proper citation: RRID:Addgene_187872 Copy   

•   Source: Addgene

http://www.addgene.org/183241

Species: Escherichia coli
Genetic Insert: sgRNA-FRT
Vector Backbone Description: Vector Backbone:pSC101 rep-ts; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:35411846

Proper citation: RRID:Addgene_183241 Copy   

•   Source: Addgene