Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HB101 endA::frt lambda pir Resource Report Resource Website |
RRID:Addgene_45472 | endA::frt lambda pir | Streptomycin | PMID:21306445 | Use lambda pir strain for R6K ori replication. endA was deleted for cleaner and higher yield plasmid preps. | Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | major endonuclease endA deleted | 2026-08-15 01:15:24 | 0 | |
|
pTDpelB-C_sfYFPTwinStrep Resource Report Resource Website |
RRID:Addgene_45944 | synthetic sfYFP (codon usage adapted to P.putida KT2440) | Aequorea victoria | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |
|
pTDpelB-NTwinStrep Resource Report Resource Website |
RRID:Addgene_45940 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pTD-NStrepHis Resource Report Resource Website 1+ mentions |
RRID:Addgene_45936 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 1 | |||
|
pTD-NTwinStrep_Sm Resource Report Resource Website |
RRID:Addgene_45937 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pTD-CTwinStrep Resource Report Resource Website |
RRID:Addgene_45939 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pYI001 Resource Report Resource Website |
RRID:Addgene_170833 | GUSPlus::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:57 | 0 | ||
|
pYI006 Resource Report Resource Website |
RRID:Addgene_170840 | FRO6p::GUSPlus::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:24:00 | 0 | ||
|
pREDusk-StrR-MCS Resource Report Resource Website 1+ mentions |
RRID:Addgene_188972 | Streptomycin | PMID:35998606 | Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:47 | 1 | ||||
|
DHL708 Resource Report Resource Website 1+ mentions |
RRID:Addgene_98417 | Genotype: MC4100 ∆clpPX | Streptomycin | PMID:27732583 | Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012). | Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin | 2026-08-15 01:22:39 | 1 | ||
|
pAW218 Resource Report Resource Website |
RRID:Addgene_113240 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:10 | 0 | ||
|
pAW215 Resource Report Resource Website |
RRID:Addgene_113237 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:10 | 0 | ||
|
pAW214 Resource Report Resource Website |
RRID:Addgene_113236 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:10 | 0 | ||
|
pAW213 Resource Report Resource Website |
RRID:Addgene_113235 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:10 | 0 | ||
|
pAW217 Resource Report Resource Website |
RRID:Addgene_113239 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:10 | 0 | ||
|
pAW186 Resource Report Resource Website |
RRID:Addgene_113184 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | R163A | 2026-08-15 01:02:09 | 0 | |
|
pAW151 Resource Report Resource Website |
RRID:Addgene_113183 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | R146A | 2026-08-15 01:02:09 | 0 | |
|
pAW150 Resource Report Resource Website |
RRID:Addgene_113182 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | S143A | 2026-08-15 01:02:09 | 0 | |
|
pAW209 Resource Report Resource Website |
RRID:Addgene_113188 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:09 | 0 | ||
|
pAW167 Resource Report Resource Website |
RRID:Addgene_113187 | Cas1 | E. coli | Streptomycin | PMID:28729350 | Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:02:09 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
