Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:http://www.cambia.org/daisy/cambia/2045/version/1/part/4/data/pCAMBIA1300.pdf?branch=main&language=default; Backbone Size:8958; Vector Backbone:pCambia1300; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23098881
Comments: Note- the SpeI site located within the Kanamycin resistance cassette was destroyed (tested by digest). The fact that the plasmid is growing on Kanamycin indicates that the loss of the SpeI site does not affect the plasmid's function.
Proper citation: RRID:Addgene_44183 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Gal4/DBD (1-147)
Vector Backbone Description: Backbone Size:8600; Vector Backbone:N103; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22704655
Proper citation: RRID:Addgene_44176 Copy
Species: Influenza virus (A/chicken/Rostock/8/34)
Genetic Insert: Influenza A virus M2 matrix gene
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23319179
Proper citation: RRID:Addgene_44170 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Atg17
Vector Backbone Description: Backbone Size:5756; Vector Backbone:pJK59; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23219485
Comments: Constructed by amplifying Atg17 with 300bp 5' of the start site.
Proper citation: RRID:Addgene_44175 Copy
Species: Influenza A/FPV/Rostock/1934, subtype H7
Genetic Insert: hemagglutinin gene
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6321; Vector Backbone:pVITRO2-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:23319179
Comments: Please note that a T55A mutation was identified in the N1 sequence.
Proper citation: RRID:Addgene_44169 Copy
Species: Mus musculus
Genetic Insert: Tak1
Vector Backbone Description: Vector Backbone:pRK6-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16260783
Proper citation: RRID:Addgene_44160 Copy
Genetic Insert: firefly luciferase
Vector Backbone Description: Backbone Marker:Promega Corporation; Backbone Size:2700; Vector Backbone:pCI; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23319179
Proper citation: RRID:Addgene_44163 Copy
Species: Synthetic
Genetic Insert: TagRFP675
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3998; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23677204
Proper citation: RRID:Addgene_44275 Copy
Species: Synthetic
Genetic Insert: TagRFP675
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5072; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23677204
Proper citation: RRID:Addgene_44277 Copy
Species: Mus musculus
Genetic Insert: K15 promoter (-4.8)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14708593
Comments: Alternate plasmid name: K15(-4.8)-pGL3
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega).
The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI.
Proper citation: RRID:Addgene_44264 Copy
Genetic Insert: SypHy1x-tdimer2(12)
Vector Backbone Description: Vector Backbone:pMH4; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23522046
Proper citation: RRID:Addgene_44268 Copy
Species: S .pyogenes
Genetic Insert: wild-type Cas9
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860
Proper citation: RRID:Addgene_44250 Copy
Genetic Insert: guide RNA (bacteria)
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860
Proper citation: RRID:Addgene_44251 Copy
Species: Homo sapiens
Genetic Insert: Pyruvate Kinase M2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18337815
Proper citation: RRID:Addgene_44242 Copy
Species: S. pyogenes
Genetic Insert: dCas9 (bacteria)
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23452860
Proper citation: RRID:Addgene_44249 Copy
Species: Homo sapiens
Genetic Insert: guide RNA
Vector Backbone Description: Vector Backbone:pU6; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452860
Proper citation: RRID:Addgene_44248 Copy
Species: Homo sapiens
Genetic Insert: Pyruvate Kinase M1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18337815
Proper citation: RRID:Addgene_44241 Copy
Species: Mus musculus
Genetic Insert: Pyruvate Kinase M1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823
Proper citation: RRID:Addgene_44240 Copy
Species: Mus musculus
Genetic Insert: Pyruvate Kinase M2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6800; Vector Backbone:pLHCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18337823
Proper citation: RRID:Addgene_44239 Copy
Species: Homo sapiens
Genetic Insert: EF1a-GFP
Vector Backbone Description: Backbone Marker:LJ Chang; Backbone Size:8738; Vector Backbone:pTY; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20517486
Proper citation: RRID:Addgene_44352 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
