Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: SSA4-U1A-ASH1 3' UTR
Vector Backbone Description: Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11142374
Comments: SSA4 promoter and SSA4 ORF (XhoI/BamHI fragment), U1A hairpins (BamHI/BglII fragment), ASH1 3' UTR (SpeI/NotI fragment), ADH2 terminator (NotI/SacII fragment), 2 micron plasmid.
Proper citation: RRID:Addgene_1371 Copy
Species: Synthetic
Genetic Insert: G(TP)4TG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137101 Copy
Species: Synthetic
Genetic Insert: GGASPAGG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137102 Copy
Species: Synthetic
Genetic Insert: GGA(EAAAK)2AGG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137104 Copy
Species: Synthetic
Genetic Insert: FKBP12
Vector Backbone Description: Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137108 Copy
Genetic Insert: mNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32072132
Comments: If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected].
Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_137075 Copy
Species: Homo sapiens
Genetic Insert: HPV 16 early region
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2476573
Proper citation: RRID:Addgene_13711 Copy
Species: Synthetic
Genetic Insert: AI(TVMV)
Vector Backbone Description: Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137111 Copy
Species: Synthetic
Genetic Insert: Con/Foff 2.0-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137123 Copy
Species: Synthetic
Genetic Insert: Con/Fon-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137122 Copy
Species: Synthetic
Genetic Insert: sRGECO
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Proper citation: RRID:Addgene_137125 Copy
Species: Synthetic
Genetic Insert: Coff/Fon-GCaMP6F
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137124 Copy
Species: Synthetic
Genetic Insert: GG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137091 Copy
Species: Synthetic
Genetic Insert: GPG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137093 Copy
Species: Synthetic
Genetic Insert: GGSG
Vector Backbone Description: Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31925441
Proper citation: RRID:Addgene_137095 Copy
Species: Synthetic
Genetic Insert: Coff/Fon-mCherry
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137134 Copy
Species: Synthetic
Genetic Insert: Con/Fon-oScarlet
Vector Backbone Description: Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
Proper citation: RRID:Addgene_137136 Copy
Species: Synthetic
Genetic Insert: Coff/Fon-ChR2-mCherry
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG
Proper citation: RRID:Addgene_137144 Copy
Species: Synthetic
Genetic Insert: Con/Foff 2.0-Arch3.3-EYFP
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Comments: Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG
Proper citation: RRID:Addgene_137149 Copy
Species: Synthetic
Genetic Insert: NpHR3.3-EYFP
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574559
Proper citation: RRID:Addgene_137151 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
