Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pPS2038
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1371 SSA4-U1A-ASH1 3' UTR Saccharomyces cerevisiae Ampicillin PMID:11142374 SSA4 promoter and SSA4 ORF (XhoI/BamHI fragment), U1A hairpins (BamHI/BglII fragment), ASH1 3' UTR (SpeI/NotI fragment), ADH2 terminator (NotI/SacII fragment), 2 micron plasmid. Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:56:07 1
pL2-G(TP)4TG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137101 G(TP)4TG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:07 1
pL2-GGASPAGG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137102 GGASPAGG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:08 1
pL2-GGA(EAAAK)2AGG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137104 GGA(EAAAK)2AGG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:07 1
pFD-FKBP12
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137108 FKBP12 Synthetic Kanamycin PMID:31925441 Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:08 1
pL0M-S-mNeonGreen-EC18153
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137075 mNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning Spectinomycin PMID:32072132 If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint. Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 12:56:11 6
pB-actin 16 Early
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13711 HPV 16 early region Homo sapiens Ampicillin PMID:2476573 Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Incl. small part of L2 2026-08-29 12:56:07 2
pFD-AI(TVMV)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137111 AI(TVMV) Synthetic Kanamycin PMID:31925441 Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:11 1
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137123 Con/Foff 2.0-GCaMP6F Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin Removed RSET tag 2026-08-29 12:56:08 3
pAAV-Ef1a-Con/Fon-GCaMP6F
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137122 Con/Fon-GCaMP6F Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin Removed RSET tag 2026-08-29 12:56:11 4
pAAV-Ef1a-sRGECO
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137125 sRGECO Synthetic Ampicillin PMID:32574559 Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin E217D 2026-08-29 12:56:11 1
pAAV-Ef1a-Coff/Fon-GCaMP6F
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137124 Coff/Fon-GCaMP6F Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin Removed RSET tag 2026-08-29 12:56:08 5
pL2-G2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137091 GG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:07 1
pL2-GPG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137093 GPG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:11 1
pL2-GGSG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137095 GGSG Synthetic Kanamycin PMID:31925441 Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 12:56:08 1
pAAV-Ef1a-Coff/Fon-mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137134 Coff/Fon-mCherry Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin n/a 2026-08-29 12:56:08 3
pAAV-Ef1a-Con/Fon-oScarlet
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137136 Con/Fon-oScarlet Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin E95D 2026-08-29 12:56:11 1
pAAV-nEF-Coff/Fon-ChR2-mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137144 Coff/Fon-ChR2-mCherry Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin H134R 2026-08-29 12:56:11 1
pAAV-nEF-Con/Foff 2.0-Arch3.3-EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137149 Con/Foff 2.0-Arch3.3-EYFP Synthetic Ampicillin PMID:32574559 Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin n/a 2026-08-29 12:56:08 1
pAAV-nEF-NpHR3.3-EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_137151 NpHR3.3-EYFP Synthetic Ampicillin PMID:32574559 Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin W179F 2026-08-29 12:56:08 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch