Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPS2038 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1371 | SSA4-U1A-ASH1 3' UTR | Saccharomyces cerevisiae | Ampicillin | PMID:11142374 | SSA4 promoter and SSA4 ORF (XhoI/BamHI fragment), U1A hairpins (BamHI/BglII fragment), ASH1 3' UTR (SpeI/NotI fragment), ADH2 terminator (NotI/SacII fragment), 2 micron plasmid. | Backbone Size:5726; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:07 | 1 | |
|
pL2-G(TP)4TG Resource Report Resource Website 1+ mentions |
RRID:Addgene_137101 | G(TP)4TG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:07 | 1 | ||
|
pL2-GGASPAGG Resource Report Resource Website 1+ mentions |
RRID:Addgene_137102 | GGASPAGG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:08 | 1 | ||
|
pL2-GGA(EAAAK)2AGG Resource Report Resource Website 1+ mentions |
RRID:Addgene_137104 | GGA(EAAAK)2AGG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:07 | 1 | ||
|
pFD-FKBP12 Resource Report Resource Website 1+ mentions |
RRID:Addgene_137108 | FKBP12 | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:08 | 1 | ||
|
pL0M-S-mNeonGreen-EC18153 Resource Report Resource Website 1+ mentions |
RRID:Addgene_137075 | mNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning | Spectinomycin | PMID:32072132 | If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected]. Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint. | Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pMS-T GeneArt® cloning vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 12:56:11 | 6 | ||
|
pB-actin 16 Early Resource Report Resource Website 1+ mentions |
RRID:Addgene_13711 | HPV 16 early region | Homo sapiens | Ampicillin | PMID:2476573 | Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Incl. small part of L2 | 2026-08-29 12:56:07 | 2 | |
|
pFD-AI(TVMV) Resource Report Resource Website 1+ mentions |
RRID:Addgene_137111 | AI(TVMV) | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pFD; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:11 | 1 | ||
|
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F Resource Report Resource Website 1+ mentions |
RRID:Addgene_137123 | Con/Foff 2.0-GCaMP6F | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | Removed RSET tag | 2026-08-29 12:56:08 | 3 |
|
pAAV-Ef1a-Con/Fon-GCaMP6F Resource Report Resource Website 1+ mentions |
RRID:Addgene_137122 | Con/Fon-GCaMP6F | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | Removed RSET tag | 2026-08-29 12:56:11 | 4 |
|
pAAV-Ef1a-sRGECO Resource Report Resource Website 1+ mentions |
RRID:Addgene_137125 | sRGECO | Synthetic | Ampicillin | PMID:32574559 | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin | E217D | 2026-08-29 12:56:11 | 1 | |
|
pAAV-Ef1a-Coff/Fon-GCaMP6F Resource Report Resource Website 1+ mentions |
RRID:Addgene_137124 | Coff/Fon-GCaMP6F | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | Removed RSET tag | 2026-08-29 12:56:08 | 5 |
|
pL2-G2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_137091 | GG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:07 | 1 | ||
|
pL2-GPG Resource Report Resource Website 1+ mentions |
RRID:Addgene_137093 | GPG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:11 | 1 | ||
|
pL2-GGSG Resource Report Resource Website 1+ mentions |
RRID:Addgene_137095 | GGSG | Synthetic | Kanamycin | PMID:31925441 | Vector Backbone:pL2; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 12:56:08 | 1 | ||
|
pAAV-Ef1a-Coff/Fon-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_137134 | Coff/Fon-mCherry | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | n/a | 2026-08-29 12:56:08 | 3 |
|
pAAV-Ef1a-Con/Fon-oScarlet Resource Report Resource Website 1+ mentions |
RRID:Addgene_137136 | Con/Fon-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | E95D | 2026-08-29 12:56:11 | 1 |
|
pAAV-nEF-Coff/Fon-ChR2-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_137144 | Coff/Fon-ChR2-mCherry | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | H134R | 2026-08-29 12:56:11 | 1 |
|
pAAV-nEF-Con/Foff 2.0-Arch3.3-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137149 | Con/Foff 2.0-Arch3.3-EYFP | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | n/a | 2026-08-29 12:56:08 | 1 |
|
pAAV-nEF-NpHR3.3-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137151 | NpHR3.3-EYFP | Synthetic | Ampicillin | PMID:32574559 | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV; Bacterial Resistance:Ampicillin | W179F | 2026-08-29 12:56:08 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.