Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBSSK Int3HA
 
Resource Report
Resource Website 		RRID:Addgene_21328 Int3 Mus musculus Ampicillin PMID:9576833 Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSSK; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin 2026-08-29 01:02:07 0
pET26-Ufd1-His
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21266 Ufd1 Mus musculus Kanamycin PMID:15371428 Addgene Next-generation sequencing QC processes identified that the insert harbors truncations of the region encoding the first 4 amino acids and final amino acid of Ufd1, relative to the NCBI reference sequence NM_011672 Backbone Marker:Novagen; Backbone Size:3000; Vector Backbone:pET26; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:02:01 2
pLKO mouse shRNA 1 raptor
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_21339 raptor shRNA 1 Mus musculus Ampicillin PMID:19150980 mouse raptor shRNA 1. shRNA oligo sequence is 5'- CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG -3' Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-29 01:02:04 65
PHyTc Notch4HA
 
Resource Report
Resource Website 		RRID:Addgene_21469 Notch4 Mus musculus Ampicillin Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:02:08 0
pIE2-AD
 
Resource Report
Resource Website 		RRID:Addgene_21603 NF-kappa-B p65 subunit Mus musculus Chloramphenicol and Tetracycline PMID:19481053 Backbone Marker:Invitrogen; Backbone Size:4635; Vector Backbone:pIZT; Vector Types:Insect Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-29 01:02:10 0
pEBG-MKK4-S255D/T259E (GST)
 
Resource Report
Resource Website 		RRID:Addgene_21566 mitogen-activated protein kinase kinase 4 Mus musculus Ampicillin PMID:7997269 phosphoacceptor site mutant, constitutively active, missing first 10 amino acids Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Serine 255 to Aspartic Acid, Threonine 259 to Glutamic Acid 2026-08-29 01:02:06 0
pEBG-MKK4-S255E/T259D (GST)
 
Resource Report
Resource Website 		RRID:Addgene_21565 mitogen-activated protein kinase kinase 4 Mus musculus Ampicillin PMID:7997269 phosphoacceptor site mutant, most constitutively active in the Kyriakis Lab at Tufts Sackler, missing first 10 amino acids Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Serine 255 to Glutamic Acid, Threonine 259 to Aspartic Acid 2026-08-29 01:02:03 0
pEBG-MKK4-K129R (GST)
 
Resource Report
Resource Website 		RRID:Addgene_21564 mitogen-activated protein kinase kinase 4 Mus musculus Ampicillin PMID:7997269 lysine mutant, inactive missing first 10 amino acids Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Lysine 129 to arginine 2026-08-29 01:02:09 0
Oct4-ires-EGFP(lox neo)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21547 EGFP, Oct4 Mus musculus Ampicillin PMID:18159219 Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-29 01:02:03 2
GwKif2CGFP
 
Resource Report
Resource Website 		RRID:Addgene_21479 Kinesin family member C2 Mus musculus Ampicillin PMID:16257958 Please note that the insert contains KifC2, as described in the associated publication, and not Kif2C as indicated in the plasmid name. Backbone Marker:Invitrogen; Backbone Size:5309; Vector Backbone:GW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:02:08 0
Bmi1 shRNA1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21576 Bmi-1 Mus musculus Ampicillin PMID:18371338 This plasmid targets the open reading frame of BMI-1. The 19mer target sequence is: GAGATAATAAGCTTGTCTA Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:02:09 2
pROSA26-1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21714 ROSA26 Mus musculus Ampicillin PMID:9916792 General ROSA26-1 targeting vector. For more information visit - http://research.mssm.edu/soriano/lab We recommend you order this plasmid along with SAbgeo and pROSA26-5' as a "ROSA26 targeting kit". Please note that although the full plasmid sequence indicates PmeI does not cut the plasmid, there is a PmeI site somewhere in the plasmid. See Notes from Addgene link above for more information. Backbone Marker:Stratagene; Backbone Size:4486; Vector Backbone:pBluescript KS (-); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-29 01:02:04 16
pROSA26-5'
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21715 ROSA26-5' insert Mus musculus Ampicillin PMID:9916792 Probe for detecting targeted integrations by Southern blots. It is a small probe so users should wash at low stringency, eg. 1xSSC at 65 degrees. We recommend you order this plasmid along with pROSA26-1 and SAbgeo as a "ROSA26 targeting kit". For more information visit - http://research.mssm.edu/soriano/lab Backbone Marker:Stratagene; Backbone Size:3027; Vector Backbone:pBluescript KS (-); Vector Types:for use with mouse targeting vector pROSA26-1; Bacterial Resistance:Ampicillin 2026-08-29 01:02:07 1
pROSA26-promoter
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21710 ROSA26 promoter Mus musculus Ampicillin PMID:9108056 Fragment 5' of exon 1; promoter fragment for driving expression. For more information visit - http://research.mssm.edu/soriano/lab Backbone Marker:Stratagene; Backbone Size:2911; Vector Backbone:pBluescript KS (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:02:11 2
pEGFP-Rubicon
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21636 Rubicon Mus musculus Kanamycin PMID:19270696 *Note: Compared to the Entrez Genbank reference sequence, Addgene's quality control sequencing finds an L617P amino acid residue substitution. The affect of this residue change is unknown. Backbone Size:4727; Vector Backbone:pEGFP-C2 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin *(see below) 2026-08-29 01:02:04 4
Clathrin-LCa-ECFP
 
Resource Report
Resource Website 		RRID:Addgene_21742 Clathrin, light polypeptide (LCa) Mus musculus Kanamycin PMID:18689690 Backbone Marker:Clonetech; Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:02:11 0
Clathrin-LCa-EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21741 Clathrin, light polypeptide (LCa) Mus musculus Kanamycin PMID:18689690 Backbone Marker:Clonetech; Backbone Size:4733; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:02:08 7
pAAV-EF1a-double floxed-Gad65-WPRE-HGHpA
 
Resource Report
Resource Website 		RRID:Addgene_184631 Gad65 Mus musculus Ampicillin PMID:35443174 Please visit https://www.biorxiv.org/content/10.1101/2021.11.26.470142v1 for bioRxiv preprint. Backbone Marker:Addgene #20297; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:14:12 0
pAAV-EF1a-double floxed-Gat1(R69K)-HA-WPRE-HGHpA
 
Resource Report
Resource Website 		RRID:Addgene_184636 Gat1 Mus musculus Ampicillin PMID:35443174 Please visit https://www.biorxiv.org/content/10.1101/2021.11.26.470142v1 for bioRxiv preprint. Backbone Marker:Addgene #20297; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin Gat1 gene with Arginine 69 changed to Lysine, to impair transport function 2026-08-29 01:14:12 0
pAAV-EF1a-double floxed-Gat1-HA-WPRE-HGHpA
 
Resource Report
Resource Website 		RRID:Addgene_184635 Gat1 Mus musculus Ampicillin PMID:35443174 Please visit https://www.biorxiv.org/content/10.1101/2021.11.26.470142v1 for bioRxiv preprint. Backbone Marker:Addgene #20297; Vector Backbone:pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 01:14:12 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch