Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCFJ210 - pDESTR4-R3(ttTi4348, I)
 
Resource Report
Resource Website
RRID:Addgene_34863 ttTi4348 targeting Caenorhabditis elegans Chloramphenicol and Ampicillin PMID:22290181 Please note there are TWO M13F primer sites. Use custom sequencing primers to sequence final gateway products. Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:55 0
p6622 MSCV-P C HA GLTSCR
 
Resource Report
Resource Website
RRID:Addgene_34902 GLTSCR1 Homo sapiens Ampicillin PMID:22232672 The GLTSCR sequence matches GenBank: AAI56273.1 and is considered a partial sequence. Backbone Size:8700; Vector Backbone:MSCV-P C-FlagHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:55 0
p6592 MSCV-IP N-HAonly WWP2
 
Resource Report
Resource Website
RRID:Addgene_34905 WWP2 Homo sapiens Ampicillin PMID:22232672 Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:55 0
p6590 MSCV-IP N-HAonly TCTE1
 
Resource Report
Resource Website
RRID:Addgene_34904 TCTE1 Homo sapiens Ampicillin PMID:22232672 Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:55 0
His-PIMT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34852 PIMT Homo sapiens Kanamycin PMID:18318686 Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:55 4
Ube1/PET21d
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_34965 Ube1 Homo sapiens Ampicillin PMID:21771579 Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:PET21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 33
pKeratin-PSmOrange2
 
Resource Report
Resource Website
RRID:Addgene_34962 PSmOrange2 Kanamycin PMID:22900938 https://www.ncbi.nlm.nih.gov/nuccore/JQ392581 In Addgene's SV40pA-R sequencing result, there is one mismatch and a two nucleotide deletion corresponding to position 2652 of the full plasmid sequence. This results in a loss of the NotI site but does not alter the function of the plasmid. Backbone Size:5275; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R17H, R36H, F64I, Q194L, A224S, G226A (mutations are relative to PSmOrange but numbering is relative to EGFP) 2026-08-15 01:13:56 0
POPTOP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34848 TCF binding sites Ampicillin PMID:18724937 Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII. There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid. Backbone Size:8000; Vector Backbone:pJIM20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin The TCF binding site is: AGATCAAAGG 2026-08-15 01:14:03 2
pDS248
 
Resource Report
Resource Website
RRID:Addgene_34968 Mid2(SS/TM)-GFP-LOVpep Saccharomyces cerevisiae Ampicillin PMID:22388287 The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin T406A, T407A, V416I 2026-08-15 01:13:56 0
pCS2+8NmCitrine
 
Resource Report
Resource Website
RRID:Addgene_34951 Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 0
pBAD-PSmOrange2
 
Resource Report
Resource Website
RRID:Addgene_34957 PSmOrange2 Ampicillin PMID:22900938 https://www.ncbi.nlm.nih.gov/nuccore/JQ392581 Backbone Marker:Invitrogen; Backbone Size:3963; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin R17H, R36H, F64I, Q194L, A224S, G226A (mutations are relative to PSmOrange but numbering is relative to EGFP) 2026-08-15 01:13:56 0
pCS2+NmCitrine-ABCB1a
 
Resource Report
Resource Website
RRID:Addgene_34956 ABCB1a Strongylocentrotus purpuratus Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 0
pCS2+8NmCherry-ABCB4a
 
Resource Report
Resource Website
RRID:Addgene_34941 ABCB4a Strongylocentrotus purpuratus Ampicillin PMID:23124201 Backbone Marker:Gokirmak et al., 2012; Backbone Size:4851; Vector Backbone:pCS2+8NmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 0
pCS2+8CCerulean-ABCG2a
 
Resource Report
Resource Website
RRID:Addgene_34946 ABCG2a Strongylocentrotus purpuratus Ampicillin PMID:23124201 Backbone Marker:Gokirmak et al., 2012; Backbone Size:4860; Vector Backbone:pCS2+8CmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 0
p6596 MSCV-IP-N-HA ADRB2
 
Resource Report
Resource Website
RRID:Addgene_34895 ADRB2 Homo sapiens Ampicillin PMID:22232672 Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:55 0
pCS2+8
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34931 Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:13:56 9
P6598 MSCV-IP N-HAonly TBPL1
 
Resource Report
Resource Website
RRID:Addgene_34896 TBPL1 Homo sapiens Ampicillin PMID:22232672 Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 0
pBSFI-p110β
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34891 p110β Homo sapiens Ampicillin PMID:16432180 Backbone Marker:Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5; Backbone Size:2949; Vector Backbone:pBSFI; Vector Types:Adaptor plasmid; Bacterial Resistance:Ampicillin 2026-08-15 01:13:55 1
pCS2+8CmCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_34935 Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 5
pCS2+8NCerulean
 
Resource Report
Resource Website
RRID:Addgene_34938 Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:14:03 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.