Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 401 showing 8001 ~ 8020 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/34863

Species: Caenorhabditis elegans
Genetic Insert: ttTi4348 targeting
Vector Backbone Description: Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22290181
Comments: Please note there are TWO M13F primer sites. Use custom sequencing primers to sequence final gateway products.

Proper citation: RRID:Addgene_34863 Copy   


http://www.addgene.org/34902

Species: Homo sapiens
Genetic Insert: GLTSCR1
Vector Backbone Description: Backbone Size:8700; Vector Backbone:MSCV-P C-FlagHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Comments: The GLTSCR sequence matches GenBank: AAI56273.1 and is considered a partial sequence.

Proper citation: RRID:Addgene_34902 Copy   


http://www.addgene.org/34905

Species: Homo sapiens
Genetic Insert: WWP2
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672

Proper citation: RRID:Addgene_34905 Copy   


http://www.addgene.org/34904

Species: Homo sapiens
Genetic Insert: TCTE1
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672

Proper citation: RRID:Addgene_34904 Copy   


  • RRID:Addgene_34852

    This resource has 1+ mentions.

http://www.addgene.org/34852

Species: Homo sapiens
Genetic Insert: PIMT
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18318686

Proper citation: RRID:Addgene_34852 Copy   


  • RRID:Addgene_34965

    This resource has 10+ mentions.

http://www.addgene.org/34965

Species: Homo sapiens
Genetic Insert: Ube1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:PET21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21771579

Proper citation: RRID:Addgene_34965 Copy   


  • RRID:Addgene_34962

http://www.addgene.org/34962

Genetic Insert: PSmOrange2
Vector Backbone Description: Backbone Size:5275; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22900938
Comments: https://www.ncbi.nlm.nih.gov/nuccore/JQ392581 In Addgene's SV40pA-R sequencing result, there is one mismatch and a two nucleotide deletion corresponding to position 2652 of the full plasmid sequence. This results in a loss of the NotI site but does not alter the function of the plasmid.

Proper citation: RRID:Addgene_34962 Copy   


  • RRID:Addgene_34848

    This resource has 1+ mentions.

http://www.addgene.org/34848

Genetic Insert: TCF binding sites
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pJIM20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18724937
Comments: Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII. There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.

Proper citation: RRID:Addgene_34848 Copy   


  • RRID:Addgene_34968

http://www.addgene.org/34968

Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.

Proper citation: RRID:Addgene_34968 Copy   


  • RRID:Addgene_34951

http://www.addgene.org/34951

Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34951 Copy   


  • RRID:Addgene_34957

http://www.addgene.org/34957

Genetic Insert: PSmOrange2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3963; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22900938
Comments: https://www.ncbi.nlm.nih.gov/nuccore/JQ392581

Proper citation: RRID:Addgene_34957 Copy   


http://www.addgene.org/34956

Species: Strongylocentrotus purpuratus
Genetic Insert: ABCB1a
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34956 Copy   


http://www.addgene.org/34941

Species: Strongylocentrotus purpuratus
Genetic Insert: ABCB4a
Vector Backbone Description: Backbone Marker:Gokirmak et al., 2012; Backbone Size:4851; Vector Backbone:pCS2+8NmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34941 Copy   


http://www.addgene.org/34946

Species: Strongylocentrotus purpuratus
Genetic Insert: ABCG2a
Vector Backbone Description: Backbone Marker:Gokirmak et al., 2012; Backbone Size:4860; Vector Backbone:pCS2+8CmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34946 Copy   


http://www.addgene.org/34895

Species: Homo sapiens
Genetic Insert: ADRB2
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672

Proper citation: RRID:Addgene_34895 Copy   


  • RRID:Addgene_34931

    This resource has 1+ mentions.

http://www.addgene.org/34931

Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34931 Copy   


http://www.addgene.org/34896

Species: Homo sapiens
Genetic Insert: TBPL1
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672

Proper citation: RRID:Addgene_34896 Copy   


  • RRID:Addgene_34891

    This resource has 1+ mentions.

http://www.addgene.org/34891

Species: Homo sapiens
Genetic Insert: p110β
Vector Backbone Description: Backbone Marker:Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5; Backbone Size:2949; Vector Backbone:pBSFI; Vector Types:Adaptor plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432180

Proper citation: RRID:Addgene_34891 Copy   


  • RRID:Addgene_34935

    This resource has 1+ mentions.

http://www.addgene.org/34935

Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34935 Copy   


  • RRID:Addgene_34938

http://www.addgene.org/34938

Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201

Proper citation: RRID:Addgene_34938 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X