Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-nEF-Coff/Fon-NpHR3.3-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137154 | Coff/Fon-NpHR3.3-EYFP | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | W179F | 2026-08-29 12:56:08 | 2 |
|
pAAV-nEF-Con/Fon-iC++-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137155 | Con/Fon-iC++-EYFP | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | n/a | 2026-08-29 12:56:09 | 3 |
|
pAAV-nEF-Con/Fon-ChRmine-oScarlet Resource Report Resource Website 1+ mentions |
RRID:Addgene_137159 | Con/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2026-08-29 12:56:11 | 2 |
|
pAAV-nEF-Coff/Fon-ChRmine-oScarlet Resource Report Resource Website 1+ mentions |
RRID:Addgene_137160 | Coff/Fon-ChRmine-p2a-oScarlet | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | oScarlet E95D | 2026-08-29 12:56:09 | 4 |
|
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137163 | Con/Foff 2.0-ChR2-EYFP | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG | Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | H134R | 2026-08-29 12:56:09 | 1 |
|
pCyCEN_Lisp2mCherry_hsp70_GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_137169 | mCherry | Other | Ampicillin and Kanamycin | PMID:31909199 | The Addgene NGS result is not a full plasmid sequence and does not completely confirm the A/T rich Plasmodium cynomolgi strain M centromere sequence. A NotI restriction digest should be used to verify the plasmid, as an intact plasmid will yield 2 bands that add up to the full plasmid size of approximately 16 kb. | Vector Backbone:PUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-29 12:56:11 | 1 | |
|
CMV_Npu-ABEmax N-terminal Resource Report Resource Website 1+ mentions |
RRID:Addgene_137173 | Npu-ABEmax_N-terminal | Synthetic | Ampicillin | PMID:31937940 | Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Cas9 D10A | 2026-08-29 12:56:09 | 1 | |
|
SIRT1.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13735 | SIRT1 | Homo sapiens | Ampicillin | PMID:16790548 | Truncated form of SIRT1. Missing amino acids 6-83. Molecular Weight: 81681 Da. | Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE-80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:11 | 4 | |
|
Cbh_v5 AAV-CBE C-terminal Resource Report Resource Website 1+ mentions |
RRID:Addgene_137176 | v5 AAV-CBE C-terminal; U6-protospacer | Synthetic | Ampicillin | PMID:31937940 | Clone in protospacer by cutting with BsmBI/Esp3I and ligating annealed oligos as described in methods. Inserts were Gibson-cloned into BshTI/BglII-restricted backbones to avoid ITR PCR. | Vector Backbone:px601; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 6 | |
|
Cbh_v5 AAV-CBE N-terminal Resource Report Resource Website 1+ mentions |
RRID:Addgene_137175 | v5 AAV-CBE N-terminal; U6-protospacer | Synthetic | Ampicillin | PMID:31937940 | Clone in protospacer by cutting with BsmBI/Esp3I and ligating annealed oligos as described in methods. Inserts were Gibson-cloned into BshTI/BglII-restricted backbones to avoid ITR PCR. | Vector Backbone:px601; Vector Types:AAV; Bacterial Resistance:Ampicillin | Cas9 D10A | 2026-08-29 12:56:09 | 3 |
|
cmv 16 E7 Flag/HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_13733 | HPV 16 E7 | Homo sapiens | Ampicillin | PMID:16775354 | Backbone Size:6550; Vector Backbone:pCMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 1 | ||
|
Cbh_v5 AAV-ABE C-terminal Resource Report Resource Website 10+ mentions |
RRID:Addgene_137178 | v5 AAV-CBE C-terminal; U6-protospacer | Synthetic | Ampicillin | PMID:31937940 | Clone in protospacer by cutting with BsmBI/Esp3I, gel-extracting product to remove RFP dropout cassette, and ligating annealed oligos as described in methods. Background colonies will be RFP+. Inserts were Gibson-cloned into BshTI/BglII-restricted backbones to avoid ITR PCR. | Vector Backbone:px601; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 10 | |
|
pGL-FLKif3A Resource Report Resource Website 1+ mentions |
RRID:Addgene_13742 | mouse Kif3A | Mus musculus | Ampicillin | PMID:11102514 | Backbone Size:5058; Vector Backbone:pGREENLANTERN-1; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 3 | ||
|
SIRT7.4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13740 | SIRT7 | Homo sapiens | Ampicillin | PMID:16790548 | Derived from pcDNA3.1 SIRT1–7 with a FLAG tag, obtained from E. Verdin (University of California, San Francisco). Molecular Weight: 44898 Da. | Backbone Marker:Qiagen; Backbone Size:4700; Vector Backbone:pQE-80; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 1 | |
|
CNC3 (CASANOVA-C3) Resource Report Resource Website 1+ mentions |
RRID:Addgene_137191 | CNC3 (CASANOVA-C3) | Synthetic | Ampicillin | PMID:33330940 | Please visit https://www.biorxiv.org/content/10.1101/858589v1 for bioRxiv preprint. | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 1 | |
|
pcDNA3-EGFP-Rac1(wt) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13719 | EGFP-Rac1(wt) | Homo sapiens | Ampicillin | PMID:11030651 | Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:11 | 14 | |
|
pcDNA3-EGFP-Rac1(Q61L) Resource Report Resource Website 10+ mentions |
RRID:Addgene_13720 | EGFP-Rac1(Q61L) | Homo sapiens | Ampicillin | PMID:11030651 | Protocols for production and use of Hahn lab biosensors and photactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:09 | 13 | |
|
pAAV-Ef1a-Coff/Fon-sRGECO Resource Report Resource Website 1+ mentions |
RRID:Addgene_137128 | Coff/Fon-sRGECO | Synthetic | Ampicillin | PMID:32574559 | Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG | Backbone Size:5300; Vector Backbone:AAV2-EF1a-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin | E217D | 2026-08-29 12:56:11 | 1 |
|
pCAG-Cre:GFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_13776 | Cre-GFP fusion protein | Bacteriophage P1 | Ampicillin | PMID:17209010 | Kozak consensus sequence was added before the start ATG. GFP-tag was added at the C-terminus of Cre. Cre-GFP fusion protein is localized in the cell nucleus. | Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:10 | 59 | |
|
pCAG-Cre Resource Report Resource Website 100+ mentions |
RRID:Addgene_13775 | Cre | Bacteriophage P1 | Ampicillin | PMID:17209010 | Kozak consensus sequence was added before the start ATG. Myc-tag was added at the C-terminus of Cre. | Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-29 12:56:10 | 126 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
