Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: ttTi4348 targeting
Vector Backbone Description: Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22290181
Comments: Please note there are TWO M13F primer sites. Use custom sequencing primers to sequence final gateway products.
Proper citation: RRID:Addgene_34863 Copy
Species: Homo sapiens
Genetic Insert: GLTSCR1
Vector Backbone Description: Backbone Size:8700; Vector Backbone:MSCV-P C-FlagHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Comments: The GLTSCR sequence matches GenBank: AAI56273.1 and is considered a partial sequence.
Proper citation: RRID:Addgene_34902 Copy
Species: Homo sapiens
Genetic Insert: WWP2
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Proper citation: RRID:Addgene_34905 Copy
Species: Homo sapiens
Genetic Insert: TCTE1
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Proper citation: RRID:Addgene_34904 Copy
Species: Homo sapiens
Genetic Insert: PIMT
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18318686
Proper citation: RRID:Addgene_34852 Copy
Species: Homo sapiens
Genetic Insert: Ube1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:PET21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21771579
Proper citation: RRID:Addgene_34965 Copy
Genetic Insert: PSmOrange2
Vector Backbone Description: Backbone Size:5275; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22900938
Comments: https://www.ncbi.nlm.nih.gov/nuccore/JQ392581
In Addgene's SV40pA-R sequencing result, there is one mismatch and a two nucleotide deletion corresponding to position 2652 of the full plasmid sequence. This results in a loss of the NotI site but does not alter the function of the plasmid.
Proper citation: RRID:Addgene_34962 Copy
Genetic Insert: TCF binding sites
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pJIM20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18724937
Comments: Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII.
There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.
Proper citation: RRID:Addgene_34848 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mid2(SS/TM)-GFP-LOVpep
Vector Backbone Description: Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22388287
Comments: The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details.
Proper citation: RRID:Addgene_34968 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34951 Copy
Genetic Insert: PSmOrange2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3963; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22900938
Comments: https://www.ncbi.nlm.nih.gov/nuccore/JQ392581
Proper citation: RRID:Addgene_34957 Copy
Species: Strongylocentrotus purpuratus
Genetic Insert: ABCB1a
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34956 Copy
Species: Strongylocentrotus purpuratus
Genetic Insert: ABCB4a
Vector Backbone Description: Backbone Marker:Gokirmak et al., 2012; Backbone Size:4851; Vector Backbone:pCS2+8NmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34941 Copy
Species: Strongylocentrotus purpuratus
Genetic Insert: ABCG2a
Vector Backbone Description: Backbone Marker:Gokirmak et al., 2012; Backbone Size:4860; Vector Backbone:pCS2+8CmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34946 Copy
Species: Homo sapiens
Genetic Insert: ADRB2
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Proper citation: RRID:Addgene_34895 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34931 Copy
Species: Homo sapiens
Genetic Insert: TBPL1
Vector Backbone Description: Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22232672
Proper citation: RRID:Addgene_34896 Copy
Species: Homo sapiens
Genetic Insert: p110β
Vector Backbone Description: Backbone Marker:Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5; Backbone Size:2949; Vector Backbone:pBSFI; Vector Types:Adaptor plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16432180
Proper citation: RRID:Addgene_34891 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34935 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_34938 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
