Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCFJ210 - pDESTR4-R3(ttTi4348, I) Resource Report Resource Website |
RRID:Addgene_34863 | ttTi4348 targeting | Caenorhabditis elegans | Chloramphenicol and Ampicillin | PMID:22290181 | Please note there are TWO M13F primer sites. Use custom sequencing primers to sequence final gateway products. | Vector Backbone:pDESTR4-R3; Vector Types:Worm targeting; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:13:55 | 0 | |
|
p6622 MSCV-P C HA GLTSCR Resource Report Resource Website |
RRID:Addgene_34902 | GLTSCR1 | Homo sapiens | Ampicillin | PMID:22232672 | The GLTSCR sequence matches GenBank: AAI56273.1 and is considered a partial sequence. | Backbone Size:8700; Vector Backbone:MSCV-P C-FlagHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:55 | 0 | |
|
p6592 MSCV-IP N-HAonly WWP2 Resource Report Resource Website |
RRID:Addgene_34905 | WWP2 | Homo sapiens | Ampicillin | PMID:22232672 | Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:55 | 0 | ||
|
p6590 MSCV-IP N-HAonly TCTE1 Resource Report Resource Website |
RRID:Addgene_34904 | TCTE1 | Homo sapiens | Ampicillin | PMID:22232672 | Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HAonly; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:55 | 0 | ||
|
His-PIMT Resource Report Resource Website 1+ mentions |
RRID:Addgene_34852 | PIMT | Homo sapiens | Kanamycin | PMID:18318686 | Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:55 | 4 | ||
|
Ube1/PET21d Resource Report Resource Website 10+ mentions |
RRID:Addgene_34965 | Ube1 | Homo sapiens | Ampicillin | PMID:21771579 | Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:PET21d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 33 | ||
|
pKeratin-PSmOrange2 Resource Report Resource Website |
RRID:Addgene_34962 | PSmOrange2 | Kanamycin | PMID:22900938 | https://www.ncbi.nlm.nih.gov/nuccore/JQ392581 In Addgene's SV40pA-R sequencing result, there is one mismatch and a two nucleotide deletion corresponding to position 2652 of the full plasmid sequence. This results in a loss of the NotI site but does not alter the function of the plasmid. | Backbone Size:5275; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | R17H, R36H, F64I, Q194L, A224S, G226A (mutations are relative to PSmOrange but numbering is relative to EGFP) | 2026-08-15 01:13:56 | 0 | |
|
POPTOP Resource Report Resource Website 1+ mentions |
RRID:Addgene_34848 | TCF binding sites | Ampicillin | PMID:18724937 | Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII. There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid. | Backbone Size:8000; Vector Backbone:pJIM20; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | The TCF binding site is: AGATCAAAGG | 2026-08-15 01:14:03 | 2 | |
|
pDS248 Resource Report Resource Website |
RRID:Addgene_34968 | Mid2(SS/TM)-GFP-LOVpep | Saccharomyces cerevisiae | Ampicillin | PMID:22388287 | The LOV2 domain is amino acids 404-540 and differs from the wild-type A. sativa LOV2 sequence by the point mutations G528A and N534E. See Strickland et al. for details. | Backbone Size:4263; Vector Backbone:YIPlac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | T406A, T407A, V416I | 2026-08-15 01:13:56 | 0 |
|
pCS2+8NmCitrine Resource Report Resource Website |
RRID:Addgene_34951 | Ampicillin | PMID:23124201 | Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 0 | ||||
|
pBAD-PSmOrange2 Resource Report Resource Website |
RRID:Addgene_34957 | PSmOrange2 | Ampicillin | PMID:22900938 | https://www.ncbi.nlm.nih.gov/nuccore/JQ392581 | Backbone Marker:Invitrogen; Backbone Size:3963; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | R17H, R36H, F64I, Q194L, A224S, G226A (mutations are relative to PSmOrange but numbering is relative to EGFP) | 2026-08-15 01:13:56 | 0 | |
|
pCS2+NmCitrine-ABCB1a Resource Report Resource Website |
RRID:Addgene_34956 | ABCB1a | Strongylocentrotus purpuratus | Ampicillin | PMID:23124201 | Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 0 | ||
|
pCS2+8NmCherry-ABCB4a Resource Report Resource Website |
RRID:Addgene_34941 | ABCB4a | Strongylocentrotus purpuratus | Ampicillin | PMID:23124201 | Backbone Marker:Gokirmak et al., 2012; Backbone Size:4851; Vector Backbone:pCS2+8NmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 0 | ||
|
pCS2+8CCerulean-ABCG2a Resource Report Resource Website |
RRID:Addgene_34946 | ABCG2a | Strongylocentrotus purpuratus | Ampicillin | PMID:23124201 | Backbone Marker:Gokirmak et al., 2012; Backbone Size:4860; Vector Backbone:pCS2+8CmCherry; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 0 | ||
|
p6596 MSCV-IP-N-HA ADRB2 Resource Report Resource Website |
RRID:Addgene_34895 | ADRB2 | Homo sapiens | Ampicillin | PMID:22232672 | Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:55 | 0 | ||
|
pCS2+8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_34931 | Ampicillin | PMID:23124201 | Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:56 | 9 | ||||
|
P6598 MSCV-IP N-HAonly TBPL1 Resource Report Resource Website |
RRID:Addgene_34896 | TBPL1 | Homo sapiens | Ampicillin | PMID:22232672 | Backbone Marker:Gateway; Backbone Size:8100; Vector Backbone:MSCV-IP N-HA only; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 0 | ||
|
pBSFI-p110β Resource Report Resource Website 1+ mentions |
RRID:Addgene_34891 | p110β | Homo sapiens | Ampicillin | PMID:16432180 | Backbone Marker:Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5; Backbone Size:2949; Vector Backbone:pBSFI; Vector Types:Adaptor plasmid; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:55 | 1 | ||
|
pCS2+8CmCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_34935 | Ampicillin | PMID:23124201 | Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 5 | ||||
|
pCS2+8NCerulean Resource Report Resource Website |
RRID:Addgene_34938 | Ampicillin | PMID:23124201 | Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:03 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
