Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 402 showing 8021 ~ 8040 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/19746

Species: Mus musculus
Genetic Insert: oligo targeting p53 and PTEN
Vector Backbone Description: Backbone Size:7994; Vector Backbone:MSCV FLIPi; Vector Types:Mammalian Expression, Retroviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18779577
Comments: Constitutively expresses puromycin-resistance and GFP. Recombines to express surface Thy1.1 and miR30-based RNAi. The miRNA is contained within an artificial intron, and splicing of the intron can boost transgene expression (1.5 to 2-fold). The expression of surface Thy1.1 facilitates antibody-mediated cell sorting. See FLIP vector protocols (PDF from this page) for more information. There are minor discrepancies between the depositor's sequence and Addgene's sequencing results. The mismatches are either coding joints or a sequencing difference between the actual and the published miR30 vector sequence.

Proper citation: RRID:Addgene_19746 Copy   


  • RRID:Addgene_19748

    This resource has 1+ mentions.

http://www.addgene.org/19748

Species: Mus musculus
Genetic Insert: oligo targeting p53
Vector Backbone Description: Backbone Size:7994; Vector Backbone:MSCV FLIPi; Vector Types:Mammalian Expression, Retroviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18779577
Comments: Constitutively expresses puromycin-resistance and GFP. Recombines to express surface Thy1.1 and miR30-based RNAi. The miRNA is contained within an artificial intron, and splicing of the intron can boost transgene expression (1.5 to 2-fold). The expression of surface Thy1.1 facilitates antibody-mediated cell sorting. See FLIP vector protocols (PDF from this page) for more information. There are minor discrepancies between the depositor's sequence and Addgene's sequencing results. The mismatches are either coding joints or a sequencing difference between the actual and the published miR30 vector sequence.

Proper citation: RRID:Addgene_19748 Copy   


  • RRID:Addgene_19711

    This resource has 1+ mentions.

http://www.addgene.org/19711

Species: Mus musculus
Genetic Insert: mouse Brn2
Vector Backbone Description: Backbone Size:4801; Vector Backbone:CAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18667607

Proper citation: RRID:Addgene_19711 Copy   


  • RRID:Addgene_19719

    This resource has 1+ mentions.

http://www.addgene.org/19719

Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914

Proper citation: RRID:Addgene_19719 Copy   


  • RRID:Addgene_19720

    This resource has 1+ mentions.

http://www.addgene.org/19720

Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914

Proper citation: RRID:Addgene_19720 Copy   


  • RRID:Addgene_19721

    This resource has 1+ mentions.

http://www.addgene.org/19721

Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog B
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914

Proper citation: RRID:Addgene_19721 Copy   


  • RRID:Addgene_19723

    This resource has 1+ mentions.

http://www.addgene.org/19723

Species: Homo sapiens
Genetic Insert: V-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17174914

Proper citation: RRID:Addgene_19723 Copy   


  • RRID:Addgene_19726

    This resource has 10+ mentions.

http://www.addgene.org/19726

Species: Homo sapiens
Genetic Insert: MKK7B2Jnk1a1
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12052897

Proper citation: RRID:Addgene_19726 Copy   


  • RRID:Addgene_19727

    This resource has 1+ mentions.

http://www.addgene.org/19727

Species: Homo sapiens
Genetic Insert: pCDNA3 FlagMKK7B2Jnk2a2
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12052897

Proper citation: RRID:Addgene_19727 Copy   


  • RRID:Addgene_19701

    This resource has 1+ mentions.

http://www.addgene.org/19701

Species: Mus musculus
Genetic Insert: Merlin I
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pXJ40-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16247032

Proper citation: RRID:Addgene_19701 Copy   


  • RRID:Addgene_19703

    This resource has 1+ mentions.

http://www.addgene.org/19703

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6938; Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19703 Copy   


  • RRID:Addgene_1977

    This resource has 1+ mentions.

http://www.addgene.org/1977

Species: Mus musculus
Genetic Insert: RASSF1C
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11857081

Proper citation: RRID:Addgene_1977 Copy   


  • RRID:Addgene_19757

    This resource has 1+ mentions.

http://www.addgene.org/19757

Species: Homo sapiens
Genetic Insert: Orai1
Vector Backbone Description: Backbone Size:0; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16921383

Proper citation: RRID:Addgene_19757 Copy   


  • RRID:Addgene_19758

    This resource has 1+ mentions.

http://www.addgene.org/19758

Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900

Proper citation: RRID:Addgene_19758 Copy   


  • RRID:Addgene_19762

    This resource has 1+ mentions.

http://www.addgene.org/19762

Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Comments: 2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is: CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT

Proper citation: RRID:Addgene_19762 Copy   


  • RRID:Addgene_19764

    This resource has 1+ mentions.

http://www.addgene.org/19764

Species: Mus musculus
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19764 Copy   


  • RRID:Addgene_19763

    This resource has 1+ mentions.

http://www.addgene.org/19763

Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19763 Copy   


  • RRID:Addgene_19766

    This resource has 1+ mentions.

http://www.addgene.org/19766

Species: Mus musculus
Genetic Insert: Oct4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site. Note that the region immediately upstream of the insert in the author's sequence is not 100% accurate. See Addgene's quality control sequence for this region.

Proper citation: RRID:Addgene_19766 Copy   


  • RRID:Addgene_19765

    This resource has 1+ mentions.

http://www.addgene.org/19765

Species: Mus musculus
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19765 Copy   


  • RRID:Addgene_1980

    This resource has 1+ mentions.

http://www.addgene.org/1980

Species: Mus musculus
Genetic Insert: RASSF1A
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11857081

Proper citation: RRID:Addgene_1980 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X