Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: IRF9 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19863 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9476899
Proper citation: RRID:Addgene_19798 Copy
Species: Homo sapiens
Genetic Insert: Fragment of p53-Binding Protein 1
Vector Backbone Description: Backbone Marker:Scott Lowe; Backbone Size:5600; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18931659
Proper citation: RRID:Addgene_19835 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pcin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19838 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19846 Copy
Species: Homo sapiens
Genetic Insert: MKL1-N100
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19848 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19775 Copy
Species: Homo sapiens
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19777 Copy
Species: Homo sapiens
Genetic Insert: NanogP8
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19776 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:8072; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_19785 Copy
Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-Scr sequence:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19825 Copy
Species: Homo sapiens
Genetic Insert: quaking homolog, KH domain RNA binding
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19870 Copy
Species: Homo sapiens
Genetic Insert: yfpsynhdat
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6516; Vector Backbone:pcihygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12065645
Proper citation: RRID:Addgene_19991 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19872 Copy
Species: Homo sapiens
Genetic Insert: Neurofibromatosis type I
Vector Backbone Description: Backbone Marker:clonetech; Backbone Size:5524; Vector Backbone:pGBT9; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8628317
Comments: The authors note that there is a mutation in the coding sequence: C3918T
"This created a T to I change within the GAP domain of NF1. However, this
change is outside of the conserved blocks within the GAP domain. This
particular residue (1195 of NF1-GRD shown in figure 4 in the chapter by
M.R. Kim and F. Tamanoi, chapter 6 in Neurofibromatosis type I from
genotype to phenotype, editor by M. Upadhyaya and D. N. Cooper BIOS
scientific publisher) is not conserved among different GAP proteins.
Therefore, we believe that the amino acid change does not affect the GAP
activity. In fact, we have used this construct for the wild-type GAP
activity."
Proper citation: RRID:Addgene_19993 Copy
Species: Rattus norvegicus
Genetic Insert: mammalian target of rapamycin-E2419K
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17360675
Proper citation: RRID:Addgene_19994 Copy
Species: Homo sapiens
Genetic Insert: PABPC4
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference.
Proper citation: RRID:Addgene_19877 Copy
Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 3
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19879 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19890 Copy
Species: Homo sapiens
Genetic Insert: Poly(A) binding protein, cytoplasmic 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19882 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.