Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: NLRP1
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33731932
Comments: Gateway pDONR vector containing NLRP1 (no stop codon)
Proper citation: RRID:Addgene_166823 Copy
Species: Homo sapiens
Genetic Insert: NLRP1
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33731932
Comments: pDONR221 encoding ubiquitin-tagged NLRP1-CT to generate a L1215 N-terminus (no stop)
Proper citation: RRID:Addgene_166828 Copy
Genetic Insert: csgBACEFG, with α-amylase fused to CsgA via flexible linker
Vector Backbone Description: Backbone Size:3763; Vector Backbone:pBb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34141524
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.11.23.394965v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_166859 Copy
Genetic Insert: csgBACEFG, with GFP-specific nanobody fused to CsgA via flexible linker
Vector Backbone Description: Backbone Size:3763; Vector Backbone:pBb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34141524
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.11.23.394965v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_166858 Copy
Species: Synthetic
Genetic Insert: SARS-COV-2 Nsp8
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34154407
Proper citation: RRID:Addgene_166861 Copy
Species: Synthetic
Genetic Insert: SARS-COV-2 Nsp7
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34154407
Proper citation: RRID:Addgene_166860 Copy
Species: Moraxella bovoculi AAX11_00205
Genetic Insert: huMb3Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92293) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174677 Copy
Species: Butyrivibrio fibrisolvens
Genetic Insert: huBfCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92301) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174672 Copy
Species: Moraxella bovoculi AAX08_00205
Genetic Insert: huMb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92292) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174676 Copy
Genetic Insert: Enhanced green fluorescent protein shRNA #1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT
Proper citation: RRID:Addgene_17470 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3030; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal EYFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction.
The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map).
GenBank accession number: EU344821
Proper citation: RRID:Addgene_17460 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2426; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal 3x HA tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction.
The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map).
GenBank accession number: EU344823
Proper citation: RRID:Addgene_17462 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2972; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal GST tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction.
The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map).
GenBank accession number: EU344826
Proper citation: RRID:Addgene_17464 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3023; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction.
The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map).
GenBank accession number: EU344826
Proper citation: RRID:Addgene_17465 Copy
Species: Synthetic
Genetic Insert: mtrCAB
Vector Backbone Description: Backbone Size:3903; Vector Backbone:pET-28a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern.
Proper citation: RRID:Addgene_174618 Copy
Species: Prevotella disiens
Genetic Insert: huPdCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #69990) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174682 Copy
Species: Eubacterium rectale
Genetic Insert: huErCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Stephen Ekker Lab (Addgene #132641) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174685 Copy
Species: Prevotella bryantii B14
Genetic Insert: huPb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174686 Copy
Species: Thiomicrospira sp. XS5
Genetic Insert: huTsCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1
Proper citation: RRID:Addgene_174687 Copy
Species: Francisella novicida
Genetic Insert: FnCas12a
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33608525
Proper citation: RRID:Addgene_174658 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.