Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 405 showing 8081 ~ 8100 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/17802

Species: Homo sapiens
Genetic Insert: ErbB4
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:3500; Vector Backbone:pM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12807903

Proper citation: RRID:Addgene_17802 Copy   


  • RRID:Addgene_178113

    This resource has 1+ mentions.

http://www.addgene.org/178113

Species: Synthetic
Genetic Insert: PEmax
Vector Backbone Description: Vector Backbone:pT7; Vector Types:Template for in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34653350
Comments: Addgene's NGS results identified a one base pair mismatch in the RT region of the plasmid relative to the depositor's reference sequence. The mismatch does not impact the amino acid sequence and is not predicted to impact plasmid function.

Proper citation: RRID:Addgene_178113 Copy   


  • RRID:Addgene_178119

http://www.addgene.org/178119

Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178119 Copy   


http://www.addgene.org/178074

Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178074 Copy   


  • RRID:Addgene_178071

http://www.addgene.org/178071

Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178071 Copy   


  • RRID:Addgene_178072

    This resource has 1+ mentions.

http://www.addgene.org/178072

Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178072 Copy   


http://www.addgene.org/178077

Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG

Proper citation: RRID:Addgene_178077 Copy   


  • RRID:Addgene_178075

http://www.addgene.org/178075

Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178075 Copy   


  • RRID:Addgene_178076

http://www.addgene.org/178076

Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178076 Copy   


http://www.addgene.org/178109

Species: Homo sapiens
Genetic Insert: ATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Proper citation: RRID:Addgene_178109 Copy   


http://www.addgene.org/178102

Genetic Insert: ATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Proper citation: RRID:Addgene_178102 Copy   


http://www.addgene.org/178108

Genetic Insert: ATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Proper citation: RRID:Addgene_178108 Copy   


http://www.addgene.org/178106

Species: Homo sapiens
Genetic Insert: ATP1A1 G8 + MTOR nick intron-45 sgRNAs
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Proper citation: RRID:Addgene_178106 Copy   


http://www.addgene.org/178067

Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178067 Copy   


http://www.addgene.org/178064

Species: Homo sapiens
Genetic Insert: WLS
Vector Backbone Description: Backbone Marker:Addgene (#51406); Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34587386

Proper citation: RRID:Addgene_178064 Copy   


  • RRID:Addgene_178136

http://www.addgene.org/178136

Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178136 Copy   


http://www.addgene.org/178094

Species: Homo sapiens
Genetic Insert: ATP1A1 G3 + EBFP nick sgRNAs
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

Proper citation: RRID:Addgene_178094 Copy   


  • RRID:Addgene_178125

http://www.addgene.org/178125

Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_178125 Copy   


  • RRID:Addgene_178084

http://www.addgene.org/178084

Vector Backbone Description: Backbone Marker:NA, Sigma, Invitrogen; Vector Backbone:pGP704-gentR, pET28b, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:34801582
Comments: The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208).

Proper citation: RRID:Addgene_178084 Copy   


  • RRID:Addgene_178085

http://www.addgene.org/178085

Vector Backbone Description: Backbone Marker:NA, NA; Backbone Size:2971; Vector Backbone:pANG01, PRK415; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:34801582
Comments: The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208).

Proper citation: RRID:Addgene_178085 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X