Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: PARP1-K893I
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, K893I) (see PMID: 8473297 for detail about the mutation)
Proper citation: RRID:Addgene_174799 Copy
Species: Homo sapiens
Genetic Insert: PARP1-W318R
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (W318R, V762A) (see PMID: 26626480 for detail about the mutation)
Proper citation: RRID:Addgene_174793 Copy
Species: Homo sapiens
Genetic Insert: PARP1-A762V
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (see PMID: 20399804 for detail about the mutation)
Proper citation: RRID:Addgene_174795 Copy
Species: Homo sapiens
Genetic Insert: PARP1-A774L
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, A774L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation)
Proper citation: RRID:Addgene_174796 Copy
Species: Homo sapiens
Genetic Insert: PARP1-A870L
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, A870L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation)
Proper citation: RRID:Addgene_174797 Copy
Species: X. perforans
Genetic Insert: GG_XopJ4, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174783 Copy
Species: N. benthamiana
Genetic Insert: GG_synthesized NbJIM2 (NbJIM2syn)-3xFLAG, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174785 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174777 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-eGFP, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174778 Copy
Species: Homo sapiens
Genetic Insert: ALC1-K77R
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame)
Please note: Plasmid contains R25P and S743C natural variants in ALC1.
Proper citation: RRID:Addgene_174813 Copy
Species: Homo sapiens
Genetic Insert: ALC1-E175Q
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame).
Please note: Plasmid contains R25P and S743C natural variants in ALC1.
Proper citation: RRID:Addgene_174814 Copy
Genetic Insert: Enhanced green fluorescent protein shRNA #2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2556; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA sequence is- 5'-CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT
Proper citation: RRID:Addgene_17471 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17473 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174772 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174773 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174774 Copy
Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454
Proper citation: RRID:Addgene_174775 Copy
Species: Homo sapiens
Genetic Insert: PARP1-G972R
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, G972R) (see PMID: 9315851 for detail about the mutation)
Proper citation: RRID:Addgene_174800 Copy
Species: Homo sapiens
Genetic Insert: PARP1-Y986H
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, Y986H) (see PMID: 9315851 for detail about the mutation)
Proper citation: RRID:Addgene_174801 Copy
Species: Homo sapiens
Genetic Insert: PARP1-Y986S
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, Y986S) (see PMID: 9315851 for detail about the mutation)
Proper citation: RRID:Addgene_174802 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.