Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pM-ErbB4-delta-kinase-PY3 mutant Resource Report Resource Website |
RRID:Addgene_17802 | ErbB4 | Homo sapiens | Ampicillin | PMID:12807903 | Backbone Marker:BD Biosciences; Backbone Size:3500; Vector Backbone:pM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Carboxy-terminal fragment, amino acids 988-1292, kinase domain deleted, Tyrosine 1301 changed to Alanine | 2026-08-15 01:11:13 | 0 | |
|
pT7-PEmax for IVT Resource Report Resource Website 1+ mentions |
RRID:Addgene_178113 | PEmax | Synthetic | Ampicillin | PMID:34653350 | Addgene's NGS results identified a one base pair mismatch in the RT region of the plasmid relative to the depositor's reference sequence. The mismatch does not impact the amino acid sequence and is not predicted to impact plasmid function. | Vector Backbone:pT7; Vector Types:Template for in vitro transcription; Bacterial Resistance:Ampicillin | Detailed in manuscript | 2026-08-15 01:11:14 | 7 |
|
UBQLN2_Halo_C_allele Resource Report Resource Website |
RRID:Addgene_178119 | Halotag | Homo sapiens | Ampicillin | Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |||
|
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_178074 | MZT2A | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:14 | 3 | ||
|
pACEBac1-GCP5 Resource Report Resource Website |
RRID:Addgene_178071 | GCP5 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:14 | 0 | ||
|
pACEBac1-GCP6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_178072 | GCP6 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:13 | 1 | ||
|
pACEBac1-gamma-tubulin(N229A)-TEV-His6 Resource Report Resource Website |
RRID:Addgene_178077 | gamma-tubulin with an N229A point mutation | Homo sapiens | Gentamicin | PMID:33496729 | Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Changed Asparagine 229 to Alanine | 2026-08-15 01:11:14 | 0 |
|
pACEBac1-MZT1 Resource Report Resource Website |
RRID:Addgene_178075 | MZT1 | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:13 | 0 | ||
|
pACEBac1-beta-actin Resource Report Resource Website |
RRID:Addgene_178076 | beta-actin | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:13 | 0 | ||
|
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA Resource Report Resource Website |
RRID:Addgene_178109 | ATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA | Homo sapiens | Ampicillin | PMID:36207338 | Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. | Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |
|
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA Resource Report Resource Website |
RRID:Addgene_178102 | ATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA | Ampicillin | PMID:36207338 | Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. | Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | ||
|
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA Resource Report Resource Website |
RRID:Addgene_178108 | ATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA | Ampicillin | PMID:36207338 | Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. | Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | ||
|
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA Resource Report Resource Website |
RRID:Addgene_178106 | ATP1A1 G8 + MTOR nick intron-45 sgRNAs | Homo sapiens | Ampicillin | PMID:36207338 | Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |
|
pACEBac1-gamma-tubulin-TEV-His6 Resource Report Resource Website |
RRID:Addgene_178067 | gamma-tubulin | Homo sapiens | Gentamicin | PMID:33496729 | Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:13 | 0 | ||
|
pcDNA3-I531T-WLS-HA-IRES-GFP Resource Report Resource Website |
RRID:Addgene_178064 | WLS | Homo sapiens | Ampicillin | PMID:34587386 | Backbone Marker:Addgene (#51406); Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I531T | 2026-08-15 01:11:13 | 0 | |
|
ANXA11_Halo_C_allele Resource Report Resource Website |
RRID:Addgene_178136 | Halotag | Homo sapiens | Ampicillin | Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |||
|
ATP1A1_G3_EBFP_Nick_Dual_sgRNA Resource Report Resource Website |
RRID:Addgene_178094 | ATP1A1 G3 + EBFP nick sgRNAs | Homo sapiens | Ampicillin | PMID:36207338 | Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |
|
GRN_Halo_C_allele Resource Report Resource Website |
RRID:Addgene_178125 | Halotag | Homo sapiens | Ampicillin | Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:11:14 | 0 | |||
|
pANG02 Resource Report Resource Website |
RRID:Addgene_178084 | Chloramphenicol and Gentamicin | PMID:34801582 | The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208). | Backbone Marker:NA, Sigma, Invitrogen; Vector Backbone:pGP704-gentR, pET28b, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin | 2026-08-15 01:11:13 | 0 | |||
|
pANG03 Resource Report Resource Website |
RRID:Addgene_178085 | Chloramphenicol and Tetracycline | PMID:34801582 | The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208). | Backbone Marker:NA, NA; Backbone Size:2971; Vector Backbone:pANG01, PRK415; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:11:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.