Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pM-ErbB4-delta-kinase-PY3 mutant
 
Resource Report
Resource Website
RRID:Addgene_17802 ErbB4 Homo sapiens Ampicillin PMID:12807903 Backbone Marker:BD Biosciences; Backbone Size:3500; Vector Backbone:pM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Carboxy-terminal fragment, amino acids 988-1292, kinase domain deleted, Tyrosine 1301 changed to Alanine 2026-08-15 01:11:13 0
pT7-PEmax for IVT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_178113 PEmax Synthetic Ampicillin PMID:34653350 Addgene's NGS results identified a one base pair mismatch in the RT region of the plasmid relative to the depositor's reference sequence. The mismatch does not impact the amino acid sequence and is not predicted to impact plasmid function. Vector Backbone:pT7; Vector Types:Template for in vitro transcription; Bacterial Resistance:Ampicillin Detailed in manuscript 2026-08-15 01:11:14 7
UBQLN2_Halo_C_allele
 
Resource Report
Resource Website
RRID:Addgene_178119 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_178074 MZT2A Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:14 3
pACEBac1-GCP5
 
Resource Report
Resource Website
RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:14 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website
RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine 2026-08-15 01:11:14 0
pACEBac1-MZT1
 
Resource Report
Resource Website
RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
pACEBac1-beta-actin
 
Resource Report
Resource Website
RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
 
Resource Report
Resource Website
RRID:Addgene_178109 ATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA Homo sapiens Ampicillin PMID:36207338 Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
 
Resource Report
Resource Website
RRID:Addgene_178102 ATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA Ampicillin PMID:36207338 Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
 
Resource Report
Resource Website
RRID:Addgene_178108 ATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA Ampicillin PMID:36207338 Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
 
Resource Report
Resource Website
RRID:Addgene_178106 ATP1A1 G8 + MTOR nick intron-45 sgRNAs Homo sapiens Ampicillin PMID:36207338 Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website
RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-08-15 01:11:13 0
pcDNA3-I531T-WLS-HA-IRES-GFP
 
Resource Report
Resource Website
RRID:Addgene_178064 WLS Homo sapiens Ampicillin PMID:34587386 Backbone Marker:Addgene (#51406); Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I531T 2026-08-15 01:11:13 0
ANXA11_Halo_C_allele
 
Resource Report
Resource Website
RRID:Addgene_178136 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
 
Resource Report
Resource Website
RRID:Addgene_178094 ATP1A1 G3 + EBFP nick sgRNAs Homo sapiens Ampicillin PMID:36207338 Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
GRN_Halo_C_allele
 
Resource Report
Resource Website
RRID:Addgene_178125 Halotag Homo sapiens Ampicillin Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin 2026-08-15 01:11:14 0
pANG02
 
Resource Report
Resource Website
RRID:Addgene_178084 Chloramphenicol and Gentamicin PMID:34801582 The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208). Backbone Marker:NA, Sigma, Invitrogen; Vector Backbone:pGP704-gentR, pET28b, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin 2026-08-15 01:11:13 0
pANG03
 
Resource Report
Resource Website
RRID:Addgene_178085 Chloramphenicol and Tetracycline PMID:34801582 The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208). Backbone Marker:NA, NA; Backbone Size:2971; Vector Backbone:pANG01, PRK415; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:11:13 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.